BME103:T130 Group 16 l2: Difference between revisions
Adam M White (talk | contribs) |
|||
(43 intermediate revisions by 4 users not shown) | |||
Line 15: | Line 15: | ||
| [[Image:heather3.JPG|100px|thumb|Name: Heather Borgard<br>Open PCR Machine Engineer]] | | [[Image:heather3.JPG|100px|thumb|Name: Heather Borgard<br>Open PCR Machine Engineer]] | ||
| [[Image:Ashley8.png|100px|thumb|Name: Ashley Guerrero<br>Open PCR Machine Engineer]] | | [[Image:Ashley8.png|100px|thumb|Name: Ashley Guerrero<br>Open PCR Machine Engineer]] | ||
| [[Image: | | [[Image:photo-2.JPG|100px|thumb|Name: Zonash Zainab<br>Experiment Protocol Planner]] | ||
| [[Image:BME103student.jpg|100px|thumb|Name: Adam White<br> | | [[Image:BME103student.jpg|100px|thumb|Name: Adam White<br>Research and Design Specialist]] | ||
| [[Image: | | [[Image:graduation.jpg|100px|thumb|Name: Brayden Gallimore<br>Research and Design Specialist]] | ||
|} | |} | ||
Line 35: | Line 35: | ||
'''Purpose'''<br> | '''Purpose'''<br> | ||
To create a uniform and faster heating system. | To create a uniform and faster heating system, replacing a rectangule heated block with three heated silver discs that will more efficiently and more quickly heat the system through rotations during cycles. | ||
Line 81: | Line 81: | ||
etc. | etc. | ||
---> | ---> | ||
The changes we made to our PCR machine include the additions of a new lid with multiple heating blocks, rather than just one, and of a revolving mechanism which is capable of holding multiple PCR tubes at one time. Multiple heating blocks allows for faster cycles because they eliminate the time it takes to heat/cool a mere one block repeatedly in order to replicate the DNA. Now, the test DNA can be quickly moved to preheated blocks without the lag time. Also, multiple DNA samples may be replicated at one time depending on the block temperature set-up and positioning of the PCR tubes in the revolver. By this method, literally an infinite amount of DNA samples can be replicated all at once, depending on the size of the machine of course. But, as far as our innovated machine goes, up to three separate samples may be run within a 2-hour period. The volume of the reaction remains the same as it was in the old machine, and DNA measurement must be done separately via a fluorimeter.<br> | The changes we made to our PCR machine include the additions of a new lid with multiple heating blocks, rather than just one, and of a revolving mechanism which is capable of holding multiple PCR tubes at one time. Multiple heating blocks allows for faster cycles because they eliminate the time it takes to heat/cool a mere one block repeatedly in order to replicate the DNA. Now, the test DNA can be quickly moved to preheated blocks without the lag time. Also, multiple DNA samples may be replicated at one time depending on the block temperature set-up and positioning of the PCR tubes in the revolver. By this method, literally an infinite amount of DNA samples can be replicated all at once, depending on the size of the machine of course. But, as far as our innovated machine goes, up to three separate samples may be run within a 2-hour period. The volume of the reaction remains the same as it was in the old machine, and DNA measurement must be done separately via a fluorimeter.<br><br> | ||
'''Materials'''<br> | '''Materials''':<br> | ||
Mounting rectangular plate with circular cutouts<br>
| |||
3 heated silver discs<br> | |||
3 white insulation covers<br> | |||
blue allen wrench<br> | |||
4 plastic washers<br> | |||
spacers<br> | |||
4 black screws<br> | |||
4 shoulder bolts<br><br> | |||
<!--- Place your two tables "Supplied in the kit" and "Supplied by User" here ---> | <!--- Place your two tables "Supplied in the kit" and "Supplied by User" here ---> | ||
Line 142: | Line 150: | ||
5. Indicate to the machine which slot has been selected by the user<br> | 5. Indicate to the machine which slot has been selected by the user<br> | ||
6. Initiate the program<br> | 6. Initiate the program<br> | ||
'''The components of the GoTaq Colorless Master Mix''': dNTP;s, MgCl2, and reaction buffers | |||
Line 162: | Line 172: | ||
15. Clean off slide<br> | 15. Clean off slide<br> | ||
16. Repeat step 1-15 making sure to use clean pipettes so as to not contaminate test solutions, or repeat steps 1-14 by using the other rows on the slide<br> | 16. Repeat step 1-15 making sure to use clean pipettes so as to not contaminate test solutions, or repeat steps 1-14 by using the other rows on the slide<br> | ||
17. This lab also requires a run through of water from the scintillation vial using the same procedure to serve as a negative control<br><br> | 17. This lab also requires a run through of water from the scintillation vial using the same procedure to serve as a negative control | ||
'''Opening Image J Procedure:'''<br> | |||
1. The first step is to connect the camera phone to the computer that has an ImageJ already installed.<br> | |||
2. Choose where the smartphone listed can be found and then double click on it; this should be under “my computer”.<br> | |||
3. After opening the DCIM folder, select the camera.<br> | |||
4. The photos the group will be taking can be placed in a created folder.<br> | |||
5. Open ImageJ and locate the file and choose the option to open upon clicking on it.<br> | |||
6. You can keep opening different pictures after selecting browse then picking the picture for which your group must use.<br><br> | |||
==Research and Development== | ==Research and Development== | ||
Line 172: | Line 192: | ||
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | <!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | ||
One of the genes we examined is associated with Alzheimer's Disease, a progressive neurologic disease of the brain that is the most common type of Dementia. In patients diagnosed with Alzheimer's Disease, Plaques, deposits of protein | One of the genes we examined is associated with '''Alzheimer's Disease''', a progressive neurologic disease of the brain that is the most common type of Dementia. In patients diagnosed with Alzheimer's Disease, Plaques, deposits of protein fragments that build up between nerve cells, and Tangles, twisted fibers of protein that build up inside cells, both develop within the brain which kills brain cells. Alzheimer's patients also have a deficiency of Neurotransmitters which are involved in the transmission of messages in the brain. All of this leads to the irreversible loss of neurons in the brain, which over time leads to the loss of intellectual abilities, specifically memory and reasoning. As the disease progresses, the loss of these abilities hampers social and occupational functioning. | ||
Reference Number: rs63750973 | Reference Number: rs63750973 | ||
Line 187: | Line 207: | ||
The second gene we examined is linked to | The second gene we examined is linked to '''Sickle Cell Anemia''', the most common form of Sickle Cell Disease, a disorder in which the body literally makes sickle-shaped (or crescent-shaped) red blood cells instead of normal doughnut shaped red blood cells. Sickle cells contain abnormal hemoglobin, an iron rich protein that carries oxygen from the lungs throughout the rest of the body. This abnormality results in the sickle shape of the cells. Unlike normal red blood cells, sickle cells are sticky and stiff and do not flow through blood vessels easily, which often leads to the blockage of blood flow in limbs and organs, leading to pain, organ damage, and sometimes infection. In patients with Sickle Cell Anemia, the anemia part of the disease causes there to be a less than normal number of red blood cells in the blood stream. Since the red blood cells are sickle cells, they die much quicker than normal red blood cells and the body cannot make new cells to replace the dying ones fast enough. | ||
Reference Number: rs78478128 | Reference Number: rs78478128 | ||
Line 208: | Line 228: | ||
''Alzheimers Gene'' | ''Alzheimers Gene'' | ||
Forward Primer: | Forward Primer: '''5'''' CATAGCGA'''[T]'''AGTGATCGTCA '''3'''' | ||
Reverse Primer: | Reverse Primer: '''3'''' GTATCGCT'''[A]'''TCACTAGCAGT '''5'''' | ||
''Sickle Cell Anemia Gene'' | ''Sickle Cell Anemia Gene'' | ||
Forward Primer: | Forward Primer: '''5'''' TCTTCTTG'''[G]'''CCAGGTCACCC '''3'''' | ||
Reverse Primer: | Reverse Primer: '''3'''' AGAAGAAC'''[C]'''GGTCCAGTGGG '''5'''' | ||
A disease allele will produce a PCR product because the mutation in a disease carrying sample would make the proper sequence to bind to the primer, whereas a non-disease allele that does not possess the specific mutated base (the C→T mutated base for the Alzheimer's gene and the C→G mutated base for the Sickle Cell gene) would not have the correct sequence to bind to the primer. The primers are also within the ideal 18-22 bp length and abide by the GC Clamp rule, proving that all of the primers would be effective. | |||
Line 223: | Line 244: | ||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
[[Image:Allele3.jpg]] | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
Latest revision as of 14:58, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design
Instructions 1. Find the 3 heated silver discs and fit them into the mounting rectangular plate where the cutouts are.
ProtocolsThe changes we made to our PCR machine include the additions of a new lid with multiple heating blocks, rather than just one, and of a revolving mechanism which is capable of holding multiple PCR tubes at one time. Multiple heating blocks allows for faster cycles because they eliminate the time it takes to heat/cool a mere one block repeatedly in order to replicate the DNA. Now, the test DNA can be quickly moved to preheated blocks without the lag time. Also, multiple DNA samples may be replicated at one time depending on the block temperature set-up and positioning of the PCR tubes in the revolver. By this method, literally an infinite amount of DNA samples can be replicated all at once, depending on the size of the machine of course. But, as far as our innovated machine goes, up to three separate samples may be run within a 2-hour period. The volume of the reaction remains the same as it was in the old machine, and DNA measurement must be done separately via a fluorimeter.
Supplied by User
1. Create a new trial on the Open PCR program
3. Add PCR Master Mix (Extracted DNA, primers, Taq Polymerase) to PCR tube The components of the GoTaq Colorless Master Mix: dNTP;s, MgCl2, and reaction buffers
1. Prop up black box to block outside light pollution, but with one side open for access to take pictures
1. The first step is to connect the camera phone to the computer that has an ImageJ already installed. Research and DevelopmentBackground on Disease Markers One of the genes we examined is associated with Alzheimer's Disease, a progressive neurologic disease of the brain that is the most common type of Dementia. In patients diagnosed with Alzheimer's Disease, Plaques, deposits of protein fragments that build up between nerve cells, and Tangles, twisted fibers of protein that build up inside cells, both develop within the brain which kills brain cells. Alzheimer's patients also have a deficiency of Neurotransmitters which are involved in the transmission of messages in the brain. All of this leads to the irreversible loss of neurons in the brain, which over time leads to the loss of intellectual abilities, specifically memory and reasoning. As the disease progresses, the loss of these abilities hampers social and occupational functioning. Reference Number: rs63750973 Chromosome located on: 21 Gene ID: APP Allele Change: C → T Residue Change: T [Thr] → I[Ile] Gene Sequence: CATGGTGGGCGGTGTTGTCATAGCGA[C/T]AGTGATCGTCATCACCTTGGTGATG
Reference Number: rs78478128 Chromosome located on: X Gene ID: G6PD Allele Change: C → G Residue Change: A [Ala] → G [Gly] Gene Sequence: AGATGGTGGGGTAGATCTTCTTCTTG[C/G]CCAGGTCACCCTGTGGCAGAGGGAA
Forward Primer: 5' CATAGCGA[T]AGTGATCGTCA 3' Reverse Primer: 3' GTATCGCT[A]TCACTAGCAGT 5' Sickle Cell Anemia Gene Forward Primer: 5' TCTTCTTG[G]CCAGGTCACCC 3' Reverse Primer: 3' AGAAGAAC[C]GGTCCAGTGGG 5' A disease allele will produce a PCR product because the mutation in a disease carrying sample would make the proper sequence to bind to the primer, whereas a non-disease allele that does not possess the specific mutated base (the C→T mutated base for the Alzheimer's gene and the C→G mutated base for the Sickle Cell gene) would not have the correct sequence to bind to the primer. The primers are also within the ideal 18-22 bp length and abide by the GC Clamp rule, proving that all of the primers would be effective.
|