BME103:T130 Group 16 l2: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 208: Line 208:
''Alzheimers Gene''
''Alzheimers Gene''


Forward Primer: ''5''' CATAGCGATAGTGATCGTCA ''3'''
Forward Primer: 5' CATAGCGA'''T'''AGTGATCGTCA 3'


Reverse Primer:
Reverse Primer:

Revision as of 11:50, 29 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Heather Borgard
Open PCR Machine Engineer
Name: Ashley Guerrero
Open PCR Machine Engineer
Name: Zonash Zainab
Experiment Protocol Planner
Name: Adam White
Role(s)
Name: Brayden Gallimore
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.

System Design




Purpose
To create a uniform and faster heating system.


Key Features

  • 3 silver heating discs that allow a faster heat/cool rate, that will be heated to different temperatures.
  • A rotating system that will rotate the discs for each cycle to optimize PCR time. As one disc heats, another cools in preparation for the future cylces and vice versa.


Materials
mounting rectangular plate with circular cutouts
3 heated silver discs
3 white insulation covers
blue allen wrench
4 plastic washers, spacers
4 black screws
4 shoulder bolts

Instructions

1. Find the 3 heated silver discs and fit them into the mounting rectangular plate where the cutouts are.
2. Take the adhesive off of a white insulation circle and then place it over a heated disc so it overlaps and hold the discs in place. repeat for other two.
3. After the heated lid bracket has been assembled, attach the mounting rectangular plate with heated discs onto heated lid bracket by screwing the shoulder bolts on with the blue allen wrench.
4. Attach this piece (lid casting) to the assembly with 4 black screws.

  • Note: Make sure the discs fit in the mounting rectangular places correctly and that the insulation completely covers them with no air bubbles underneath otherwise it could break during cycling.
  • Note: The discs will be rotated by the handle on top. as the knob for the heated lid handle is turned, the heated discs will move. The discs need to be turned for each cycle, to effectively heat or cool the DNA. Although this process takes away from the autonomous aspect of the PCR machine, the system will work more effectively and quickly overall.





Protocols

The changes we made to our PCR machine include the additions of a new lid with multiple heating blocks, rather than just one, and of a revolving mechanism which is capable of holding multiple PCR tubes at one time. Multiple heating blocks allows for faster cycles because they eliminate the time it takes to heat/cool a mere one block repeatedly in order to replicate the DNA. Now, the test DNA can be quickly moved to preheated blocks without the lag time. Also, multiple DNA samples may be replicated at one time depending on the block temperature set-up and positioning of the PCR tubes in the revolver. By this method, literally an infinite amount of DNA samples can be replicated all at once, depending on the size of the machine of course. But, as far as our innovated machine goes, up to three separate samples may be run within a 2-hour period. The volume of the reaction remains the same as it was in the old machine, and DNA measurement must be done separately via a fluorimeter.

Materials


Supplied in the kit

Material Amount
PCR Machine 1
Fluorimeter w/ LED light 1
Hydrophobic Slide 1
Smart Phone/Camera Stand 1
Light-Cancelling Box 1


Supplied by User

Material Amount
Sample DNA 0.2 μL
10 μM Forward Primer 1.0 μL
10 μM Reverse Primer 1.0 μL
GoTaq Master Mix 50.0 μL
Distilled Water 47.8 μL
Pipette 16
Eppendorf Tube 16
SYBR Green 0.1 mL
Smart Phone/Camera 1



PCR Protocol

This new protocol is slightly different than the original; rather than setting one block to do all the work of heating and cooling, the new machine has multiple blocks which keep a constant temperature while the rotating mechanism (containing the DNA in a PCR tube) simply switches between them. This method is much faster as it eliminates the time it takes to heat and cool one block over and over again. In addition, the protocol remains nearly unchanged. The only difference in the protocol now is to set the specific temperatures, amount of cycles, and times to individual and respective blocks, instead of just one block. Also, it is imperative that the user indicate to the machine into which slot they have placed the PCR tube. There are multiple receivers for the PCR tube in the new revolving mechanism, so the machine needs to know exactly which receiver the user has selected. Otherwise, the machine will conduct the cycles on a PCR tube which is not present, meanwhile the slot which actually holds the PCR tube never sees the heating/cooling blocks. It is a menial addition to the programming of the machine, but can make a huge difference in the outcome of a trial.

1. Create a new trial on the Open PCR program
2. Set three blocks and a final hold to desired specifications

  • Block One:(Denaturation) 1 cycle at 95°C - 3 minutes
  • Block Two:(Annealing) 30 cycles at 95°C - 30 seconds/57°C - 30 seconds/72°C - 30 seconds
  • Block Three:(Synthesis) 72°C - 3 minutes
  • Block Four-Final Hold: 4°C

3. Add PCR Master Mix (Extracted DNA, primers, Taq Polymerase) to PCR tube
4. Insert tube into the revolving mechanism of the PCR machine
5. Indicate to the machine which slot has been selected by the user
6. Initiate the program


DNA Measurement Protocol

No changes were made to the method of measuring DNA. A fluorimeter is the best way to do this, and, seeing as no changes were made to the fluorimeter given to our group, the protocol remains the same.

1. Prop up black box to block outside light pollution, but with one side open for access to take pictures
2.Use a permanent marker to number transfer pipettes at the bulb so as to use only one pipette per sample
3.Use the permanent marker again to number the Eppendorf tubes at the top (should yield 10 Eppendorf tubes and 10 Pipettes labeled by this step)
4. Using one pipette per sample, transfer each sample separately into an Eppendorf tube containing 400 ml of buffer
5. Label the tubes to correspond with the numbers of the samples
7. Place slide in fluorimeter (glass side facing downward)
8. Place two drops of solution from an Eppendorf tube containing SYBR GREEN I (make sure to use only the corresponding pipette to do this) on the middle hole in any of the rows on the slide
9. Place two drops of diluted PCR solution on top of the SYBR GREEN I drops
10. Align the now big drop with the blue light of the fluorimeter
11. Move fluorimeter to darkest area within the box and turn on blue light
12. Position smartphone/camera inside holder as close to fluorimeter while maintaining optimal focus
13. Bring down flap on top of your arm, which should be inside the box in order to take the picture with hand, in order to maximize darkness within the assembly
14. Take picture (capture multiple images since camera might not focus on first exposure)
15. Clean off slide
16. Repeat step 1-15 making sure to use clean pipettes so as to not contaminate test solutions, or repeat steps 1-14 by using the other rows on the slide
17. This lab also requires a run through of water from the scintillation vial using the same procedure to serve as a negative control

Research and Development

Background on Disease Markers

One of the genes we examined is associated with Alzheimer's Disease, a progressive neurologic disease of the brain that is the most common type of Dementia. In patients diagnosed with Alzheimer's Disease, Plaques, deposits of protein fragment that build up between nerve cells, and Tangles, twisted fibers of protein that build up inside cells, both develop within the brain which kills brain cells. Alzheimer's patients also have a deficiency of Neurotransmitters which are involved in the transmission of messages in the brain. All of this leads to the irreversible loss of neurons in the brain, which over time leads to the loss of intellectual abilities, specifically memory and reasoning. As the disease progresses, the loss of these abilities hampers social and occupational functioning.

Reference Number: rs63750973

Chromosome located on: 21

Gene ID: APP

Allele Change: C → T

Residue Change: T [Thr] → I[Ile]

Gene Sequence: CATGGTGGGCGGTGTTGTCATAGCGA[C/T]AGTGATCGTCATCACCTTGGTGATG


The second gene we examined is linked to Sick Cell Anemia, the most common form of Sickle Cell Disease, a disorder in which the body literally makes sickle-shaped (or crescent-shaped) red blood cells instead of normal doughnut shaped red blood cells. Sickle cells contain abnormal hemoglobin, an iron rich protein that carries oxygen from the lungs throughout the rest of the body. This abnormality results in the sickle shape of the cells. Unlike normal red blood cells, sickle cells are sticky and stiff and do not flow through blood vessels easily, which often leads to the blockage of blood flow in limbs and organs, leading to pain, organ damage, and sometimes infection. In patients with Sickle Cell Anemia, the anemia part of the disease causes there to be a less than normal number of red blood cells in the blood stream. Since the red blood cells are sickle cells, they die much quicker than normal red blood cells and the body cannot make new cells to replace the dying ones fast enough.

Reference Number: rs78478128

Chromosome located on: X

Gene ID: G6PD

Allele Change: C → G

Residue Change: A [Ala] → G [Gly]

Gene Sequence: AGATGGTGGGGTAGATCTTCTTCTTG[C/G]CCAGGTCACCCTGTGGCAGAGGGAA


Primer Design


Alzheimers Gene

Forward Primer: 5' CATAGCGATAGTGATCGTCA 3'

Reverse Primer:

Sickle Cell Anemia Gene

Forward Primer:

Reverse Primer:


Illustration