BME103:T130 Group 16 l2: Difference between revisions
Adam M White (talk | contribs) |
Adam M White (talk | contribs) |
||
Line 130: | Line 130: | ||
'''PCR Protocol'''<br><br> | '''PCR Protocol'''<br><br> | ||
This new protocol is slightly different than the original; rather than setting one block to do all the work of heating and cooling, the new machine has multiple blocks which keep a constant temperature while the rotating mechanism (containing the DNA in a PCR tube) simply switches between them. This method is much faster as it eliminates the time it takes to heat and cool one block over and over again. In addition, the protocol remains nearly unchanged. The only difference in the protocol now is to set the specific temperatures, amount of cycles, and times to individual and respective blocks, instead of just one block. Also, it is imperative that the user indicate to the machine into which slot they have placed the PCR tube. There are multiple receivers for the PCR tube in the new revolving mechanism, so the machine needs to know exactly which receiver the user has selected. Otherwise, the machine will conduct the cycles on a PCR tube which is not present, meanwhile the slot which actually holds the PCR tube never sees the heating/cooling blocks. It is a menial addition to the programming of the machine, but can make a huge difference in the outcome of a trial. <br> | This new protocol is slightly different than the original; rather than setting one block to do all the work of heating and cooling, the new machine has multiple blocks which keep a constant temperature while the rotating mechanism (containing the DNA in a PCR tube) simply switches between them. This method is much faster as it eliminates the time it takes to heat and cool one block over and over again. In addition, the protocol remains nearly unchanged. The only difference in the protocol now is to set the specific temperatures, amount of cycles, and times to individual and respective blocks, instead of just one block. Also, it is imperative that the user indicate to the machine into which slot they have placed the PCR tube. There are multiple receivers for the PCR tube in the new revolving mechanism, so the machine needs to know exactly which receiver the user has selected. Otherwise, the machine will conduct the cycles on a PCR tube which is not present, meanwhile the slot which actually holds the PCR tube never sees the heating/cooling blocks. It is a menial addition to the programming of the machine, but can make a huge difference in the outcome of a trial. <br><br> | ||
1. Create a new trial on the Open PCR program<br> | 1. Create a new trial on the Open PCR program<br> | ||
Line 141: | Line 141: | ||
4. Insert tube into the revolving mechanism of the PCR machine<br> | 4. Insert tube into the revolving mechanism of the PCR machine<br> | ||
5. Indicate to the machine which slot has been selected by the user<br> | 5. Indicate to the machine which slot has been selected by the user<br> | ||
6. Initiate the program<br> | 6. Initiate the program<br> | ||
'''DNA Measurement Protocol'''<br><br> | |||
'''DNA Measurement Protocol'''<br> | No changes were made to the method of measuring DNA. A fluorimeter is the best way to do this, and, seeing as no changes were made to the fluorimeter given to our group, the protocol remains the same.<br><br> | ||
No changes were made to the method of measuring DNA. A fluorimeter is the best way to do this, and, seeing as no changes were made to the fluorimeter given to our group, the protocol remains the same.<br> | |||
1. Prop up black box to block outside light pollution, but with one side open for access to take pictures<br> | 1. Prop up black box to block outside light pollution, but with one side open for access to take pictures<br> |
Revision as of 11:29, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design
Instructions 1. Find the 3 heated silver discs and fit them into the mounting rectangular plate where the cutouts are.
ProtocolsMaterials
Supplied by User
1. Create a new trial on the Open PCR program
3. Add PCR Master Mix (Extracted DNA, primers, Taq Polymerase) to PCR tube
1. Prop up black box to block outside light pollution, but with one side open for access to take pictures Research and DevelopmentBackground on Disease Markers One of the genes we examined is associated with Alzheimer's Disease, a progressive neurologic disease of the brain that is the most common type of Dementia. In patients diagnosed with Alzheimer's Disease, Plaques, deposits of protein fragment that build up between nerve cells, and Tangles, twisted fibers of protein that build up inside cells, both develop within the brain which kills brain cells. Alzheimer's patients also have a deficiency of Neurotransmitters which are involved in the transmission of messages in the brain. All of this leads to the irreversible loss of neurons in the brain, which over time leads to the loss of intellectual abilities, specifically memory and reasoning. As the disease progresses, the loss of these abilities hampers social and occupational functioning. Reference Number: rs63750973 Chromosome located on: 21 Gene ID: APP Allele Change: C → T Residue Change: T [Thr] → I[Ile] Gene Sequence: CATGGTGGGCGGTGTTGTCATAGCGA[C/T]AGTGATCGTCATCACCTTGGTGATG
Reference Number: rs78478128 Chromosome located on: X Gene ID: G6PD Allele Change: C → G Residue Change: A [Ala] → G [Gly] Gene Sequence: AGATGGTGGGGTAGATCTTCTTCTTG[C/G]CCAGGTCACCCTGTGGCAGAGGGAA
Forward Primer: Reverse Primer: Sickle Cell Anemia Gene Forward Primer: Reverse Primer:
Illustration
|