BME103:T130 Group 16: Difference between revisions
Adam M White (talk | contribs) |
Adam M White (talk | contribs) |
||
Line 49: | Line 49: | ||
The Polymerase Chain Reaction (PCR) is a process which ultimately produces copies of a specific DNA sequence numbering in the millions. This is achieved by first heating a DNA sequence to between 94-96°C in order to effectively denature it into separate strands. Once separated, the reaction is cooled to anywhere between 50-65°C to allow the left and right primers to anneal, or bind, to their respective sequences. These primers keep the DNA strands apart, and they act as indicators to which region of the DNA is to be copied. Next, the temperature is raised to around 72°C for a few minutes. Within this time, the polymerase known as Taq polymerase activates and attaches to each priming site where it then synthesizes a new strand of DNA. Now that the new DNA strands have been created, cycle one is complete. Cycle two follows the same procedure as cycle one, beginning with the denaturing of the newly synthesized DNA strands, and so on. It is important to mention that, due to the way the math of the PCR cycles work out, purely synthesized and complete target DNA strands will not be available until the end of cycle three. | The Polymerase Chain Reaction (PCR) is a process which ultimately produces copies of a specific DNA sequence numbering in the millions. This is achieved by first heating a DNA sequence to between 94-96°C in order to effectively denature it into separate strands. Once separated, the reaction is cooled to anywhere between 50-65°C to allow the left and right primers to anneal, or bind, to their respective sequences. These primers keep the DNA strands apart, and they act as indicators to which region of the DNA is to be copied. Next, the temperature is raised to around 72°C for a few minutes. Within this time, the polymerase known as Taq polymerase activates and attaches to each priming site where it then synthesizes a new strand of DNA. Now that the new DNA strands have been created, cycle one is complete. Cycle two follows the same procedure as cycle one, beginning with the denaturing of the newly synthesized DNA strands, and so on. It is important to mention that, due to the way the math of the PCR cycles work out, purely synthesized and complete target DNA strands will not be available until the end of cycle three. | ||
Steps of PCR | '''Steps of PCR''' | ||
1. Create a new trial on the Open PCR program<br> | 1. Create a new trial on the Open PCR program<br> | ||
Line 62: | Line 62: | ||
<br> | <br> | ||
'''Components of PCR Master Mix'''<br> | '''Components of PCR Master Mix'''<br> | ||
*GoTaq® Colorless Master Mix<br> | |||
*Upstream primer<br> | |||
*Downstream primer<br> | |||
*DNA template<br> | |||
*Nuclease-Free Water (dH<sub>2</sub>O)<br> | |||
'''Flourimeter Measurements'''<br> | '''Flourimeter Measurements'''<br> | ||
Revision as of 10:17, 15 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UP
When the wire connecting the LCD screen to the circuit board is unplugged, the LCD will not show, but the machine will still function. The screen will not present any premature values or any details about the thermal cycler. When the white wire connecting the circuit board to the temperature sensor is unplugged, the temperature will not be changed correctly. This would cause problems in the process of DNA amplification and the primers would most likely be unable to attach to the active sites.
Test Run We first tested the PCR machine on 10/25/12 The Polymerase Chain Reaction Machine we used is a quick and inexpensive way amplify small sections of DNA. The main function of the PCR machine is to act as a DNA Thermal Cycler to isolate a specific section of DNA from a strand that has an excessive amount of genetic information. A target area on a strand of DNA is amplified and identical copies are generated using changes in temperature. The machine quickly and precisely heats and cools the DNA segments at different times over the span a a little over an hour. In cylce one, the thermal cycler heats to 95 degrees Celsius. The DNA begins to separate into two single strands. The thermal cylcer then cools to 50 degrees Celsius. The primers that were added in the tubes before the experiment then bind the target sites before the single strands pair up again. When the thermal cycle heats again to 72 degrees Celsius, DNA polymerase finds a primer to add complementary nucleotide to the strand.In cycle two the temperature is raised again to separate the DNA strands. When the temperature is lowered, the primers attach again. and the same process is repeated. In cycle three, two strands that begin with primer one and end with primer two appear. At then end of cylce four, there are even more copies of this fragment. As the cylces continue more and more copies of the target sequence will be generated. The this is especially useful to genetic mapping and detecting bio-markers. The PCR Machine is composed of a heated lid that presses against the tubes of DNA to heat during the cycles and thermal block where the tubes of DNA are placed, a heat sink, and a fan to absorb heat and cool during the different cycles, and an lcd screen to read the temperature and cylces that the thermal cycler is going though.
ProtocolsPolymerase Chain Reaction The Polymerase Chain Reaction (PCR) is a process which ultimately produces copies of a specific DNA sequence numbering in the millions. This is achieved by first heating a DNA sequence to between 94-96°C in order to effectively denature it into separate strands. Once separated, the reaction is cooled to anywhere between 50-65°C to allow the left and right primers to anneal, or bind, to their respective sequences. These primers keep the DNA strands apart, and they act as indicators to which region of the DNA is to be copied. Next, the temperature is raised to around 72°C for a few minutes. Within this time, the polymerase known as Taq polymerase activates and attaches to each priming site where it then synthesizes a new strand of DNA. Now that the new DNA strands have been created, cycle one is complete. Cycle two follows the same procedure as cycle one, beginning with the denaturing of the newly synthesized DNA strands, and so on. It is important to mention that, due to the way the math of the PCR cycles work out, purely synthesized and complete target DNA strands will not be available until the end of cycle three. Steps of PCR 1. Create a new trial on the Open PCR program
3. Add PCR Master Mix (Extracted DNA, primers, Taq Polymerase) to PCR tube
Flourimeter Measurements
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology We took the DNA samples from the open PCR and put it into an Eppendorf tube containing 400mL of buffer. Patient 1: ID 99949 Samples: + P1R1 P1R2 P1R3 Patient 2: ID 61909 Samples: - P2R1 P2R2 P2R3 Recapitulation: Template DNA from the patient (non-human) was extracted, then put into a primer (synthetic sections of DNA that, in this case, bind with the template DNA if it is cancerous). Using a PCR, the DNA was thermally cycled. First, the PCR heated the the solution to 95 degrees (C), in which the DNA was spit into 2 helicase. Then it was cooled to 57 degrees (C), where the primers attach to the specific sequence. Then it is heated to 72 degrees, where the polymerase extends DNA strand by attaching the nucleotides in order (polymerization). This process was repeated for 34 cycles, then refrigerated. There were 2 Eppendorf tubes containing: SYBR Green I (used with blue pipette) DNA Calf Thymus (2 microg/mL, used with a red pipette) The DNA Calf Thymus is green when viewed on a Smartphone when a certain dsDNA is present. First, we placed a glass slide on the fluorimeter, then put 2 drops of SYBR Green I on 2 vertically consecutive dots, connecting them. Then we placed 2 drops of + on top of the SYBR Green I, took a picture, then used a pipette to throw away the liquid waste. This procedure was repeated with P1R1, P1R2, P1R3, -, P2R1, P2R2, P2R3, and DNA calf thymus in said order. A positive result will be dyed green (because SYBR Green I dye only binds to double stranded DNA), while clear (blue on a Smartphone) indicates a negative result (non-cancerous). A negative result occurs because the primers do not bind with the DNA sequence. Patients with no cancer specific gene (rs17879961 single nucleotide polymorphism) have the ATT (nitrogenous bases adenine thymine thymine) sequence, while the ACT (nitrogenous bases adenine cytosine thymine) sequence replaces the ATT sequence in cancer patients. This gene is linked with breast and colorectal cancer. Its sequence is GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC with error [C/T] in which the T base pair mutated into a C base pair, so the primer and reverse primer are: TTGAGAATGTGACGTATGTA (Foreward) AACTCTTACACTGCATACAT (Reverse)
Bayesian Reasoning Let: A = (people with cancer and positive test)/{total number of people tested) B = (people with cancer and negative test)/{total number of people tested) C = (people without cancer and positive test)/{total number of people tested) D = (people without cancer and negative test)/{total number of people tested) The rate of cancer patients with positive results, within the group of all patients with positive results can be calculated by: A/(A+C) Let: C = cancer present T = positive test p(A|B) = probability of A, given B, ~ = not Baye's Theorem:
= A/(A+B) x 100% = p(T|C) x 100% Specificity: probability that a person who does not have the disease being test for will test negative = D/(D+C) x 100% = [1-p(T|~C)] x 100% PPV (Positive Predictive Value): probability that a person with a positive test result has the disease being tested for = A/(A+C) x 100% = p(C|T) x 100% NPV (Negative Predictive Value): probability that a person with a negative test result does not have the disease being tested for = D/(D+B) x 100%
There are 4 nitrogenous bases associated with DNA: Adenine (A), Thymine (T), Cytosine (C), and Guanine (G). In a double stranded DNA sequence, guanine is paired with cytosine (GC) while adenine is paired with thymine (AT). Structure of double-stranded DNA:
PCR Process:
1) At 95 degrees Celsius, the double stranded DNA is denatured. 2) The primers anneal to the complementary bases at 57 degrees Celsius. 3) Polymerization: The Taq polymerases amplify the DNA by extending the single-stranded DNA, making a new double-stranded DNA. 4) This was repeated 34 times.
(Images from: ScienceDirect.com and http://hshgp.genome.washington.edu/teacher_resources/modules-view.htm) ResultsThe following chart shows the results from the imagej software processing. Each image that was taken with the smart phone was analyzed through the imageJ program to establish the amount of fluorescence each "drop" produced. The images below the table show the substances that were known. Calf Thymus DNA was expected to have fluorescence, as the Water was expected to have no fluorescence. This showed that the detection method was working correctly. Water: tested negative for cancer Calf Thymus DNA: tested positive for cancer
|