BME103:T130 Group 15 l2
From OpenWetWare
(→Protocols) |
Current revision (16:58, 29 November 2012) (view source) (→OUR TEAM) |
||
| (39 intermediate revisions not shown.) | |||
| Line 13: | Line 13: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- | |- | ||
| - | | [[Image: | + | | [[Image:LilyHIMYM.jpg|100px|thumb|Alyssa Alexander<br> Research & Development]] |
| - | | [[Image: | + | | [[Image:34619322.jpg|100px|thumb|Name: Nehal Jolly<br>Research and Development]] |
| [[Image:Dolphin.gif|100px|thumb|Sichun Ai<br>protocols planner]] | | [[Image:Dolphin.gif|100px|thumb|Sichun Ai<br>protocols planner]] | ||
| - | | [[Image: | + | | [[Image:IMG 0929.jpg|100px|thumb|Malik Alnaim<br>protocols planner]] |
| - | | [[Image: | + | | [[Image:Zack De La Rocha.jpg|100px|thumb|Name: Ben Reising<br>Thermal Cycler Engineer]] |
| + | | [[Image:Georgebush.jpg|100px|thumb|Mayuri Gupta <br> Thermal Cycler Engineer]] | ||
|} | |} | ||
| Line 30: | Line 31: | ||
'''System Design'''<br> | '''System Design'''<br> | ||
| - | + | [[Image:PCR Side Air (2).jpg|400px]] | |
| + | [[Image:PCR_Front_Air_(2).jpg|400px]] | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
| - | + | As one can see in these two images, the picture features the PCR machine, stripped of everything internal except for the exhaust fan. Our idea of improving this machine is to add an additional fan, to deal with the buildup of heat. The PCR machine is designed to heat up the samples, increasing internal temperature due to the trapped heat. While the exhaust fan does assist in keeping a reasonable temperature, the hot air it removes is only directly being pushed out, there is no active air flow through the machine, which would cool it better, only an active air flow out of the machine. | |
| - | + | While only pushing air out works, adding an extra fan opposite of the exhaust fan would create air flow through the entire machine, pulling in room temperature air, allowing better circulation. If the fan were added on, there is no reason that the machine could not keep a constant temperature only a couple degrees above room temperature. | |
'''Instructions'''<br> | '''Instructions'''<br> | ||
| - | + | The overall instructions in the usage of the PCR machine will not drastically change as the individual who is using it will not have to change the manner in which they handle the machine. However; as the cooling of the allows for the samples to run at an increased pace. The exhaust fan increases the active air flow thus eliminating the time needed for cooling and reheating; in the original machine this was a large factor in the amount of time PCR took overall. Therefore the individual simply needs to input the samples in the machine as they did before as externally there have not been any changes, but the extra fan opposite of the exhaust fan will increase the air flow through the machine and cool the samples quicker. | |
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
| Line 64: | Line 66: | ||
'''Materials''' | '''Materials''' | ||
| - | + | <center> | |
{| border="1" class="wikitable" | {| border="1" class="wikitable" | ||
|+ Supplied in Kit | |+ Supplied in Kit | ||
| Line 87: | Line 89: | ||
|} | |} | ||
<br> | <br> | ||
| + | |||
| + | {| border="1" class="wikitable" | ||
| + | |+ Supplied by User | ||
| + | | Computer | ||
| + | | 1 | ||
| + | |- | ||
| + | | Smartphone with Camera | ||
| + | | 1 | ||
| + | |- | ||
| + | | Pipettes | ||
| + | | 12 | ||
| + | |- | ||
| + | | Eppendorf Tubes | ||
| + | | 8 | ||
| + | |- | ||
| + | | Distilled Water | ||
| + | | As much as needed | ||
| + | |- | ||
| + | | SYBR Green I | ||
| + | | 5 mL | ||
| + | |- | ||
| + | | Smartphone holder | ||
| + | | 1 | ||
| + | |- | ||
| + | | Fluorimeter | ||
| + | | 1 | ||
| + | |- | ||
| + | | Image J Software | ||
| + | | 1 | ||
| + | |- | ||
| + | | GoTaq Mastermix | ||
| + | | 1 | ||
| + | |- | ||
| + | | Glass slides | ||
| + | | As many as needed (1) | ||
| + | |- | ||
| + | | Calf Thymus | ||
| + | | 50 μL | ||
| + | |- | ||
| + | |} | ||
<!--- Place your two tables "Supplied in the kit" and "Supplied by User" here ---> | <!--- Place your two tables "Supplied in the kit" and "Supplied by User" here ---> | ||
| + | </center> | ||
'''PCR Protocol''' | '''PCR Protocol''' | ||
<br> | <br> | ||
'''Steps to Amplify DNA Samples'''<br> | '''Steps to Amplify DNA Samples'''<br> | ||
| - | # Collect three replicate DNA samples from two patients | + | # Collect three replicate DNA samples from two patients. (was provided already) |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
# The DNA samples are 50 μL each, get the patient's ID and label the the each tube. | # The DNA samples are 50 μL each, get the patient's ID and label the the each tube. | ||
# PCR reaction mix - Mix contains Taq DNA polymerase, MgCl<sub>2</sub>, dNTP's, forward primer, and reverse primer. | # PCR reaction mix - Mix contains Taq DNA polymerase, MgCl<sub>2</sub>, dNTP's, forward primer, and reverse primer. | ||
| Line 108: | Line 145: | ||
# The 8 tubes of mixtures will then go through the cycles in the PCR system. | # The 8 tubes of mixtures will then go through the cycles in the PCR system. | ||
#* During each step of the thermal cycling, the DNA is unzipped and heated to 95°C to break the H-bonds between the 2 strands. This exposes the part we want in this lab experiment. Then, the primer binds to the trage we want without cancer marker, this primer won't bind. Next, the temperature will be dropped to 57°C in order to bind the primer. Later, it is heat it back up to 72°C with the Taq to reform and duplicate DNA strands. Finally, this thermal cycling is repeated for amplification and add dye that binds specifically to DNA for detection. | #* During each step of the thermal cycling, the DNA is unzipped and heated to 95°C to break the H-bonds between the 2 strands. This exposes the part we want in this lab experiment. Then, the primer binds to the trage we want without cancer marker, this primer won't bind. Next, the temperature will be dropped to 57°C in order to bind the primer. Later, it is heat it back up to 72°C with the Taq to reform and duplicate DNA strands. Finally, this thermal cycling is repeated for amplification and add dye that binds specifically to DNA for detection. | ||
| + | # Pippette 50 μL DNA sample into the labeled PCR tubes. | ||
| + | # Place the pipettes separately on the table to avoid contamination | ||
| + | # Use a pipette to add 50 μL of GoTaq Master mix to each of the PCR tubes, and discard the pipette after each tube. | ||
| + | # Create a new program on the Open PCR system (connected to the computer) | ||
| + | # Create three stages | ||
| + | #* Stage 1: 1 cycle, 95°C for 3 minutes | ||
| + | #* Stage 2: 30 cycles for 95°C for 30 seconds, 57°C for 30 seconds, 72°C for 30 seconds | ||
| + | #* Stage 3. 72°C for 3 minutes | ||
| + | # Final hold: 4°C | ||
| + | # Save the Program | ||
| + | # Place PCR tubes inside the machine and push down on the lid to close it | ||
| + | # Finally, click the start button in the OpenPCR program and run the experiment. | ||
| + | |||
| + | The time for this experiment will be reduced due to the improvements made on the PCR machine. It should cycle much quicker than it did before (about an hour and a half to two hours). How much of a time difference is uncertain. | ||
<br> | <br> | ||
| Line 114: | Line 165: | ||
<br> | <br> | ||
| + | <center> | ||
'''Volumes Used for Mixture'''<br> | '''Volumes Used for Mixture'''<br> | ||
| Line 153: | Line 205: | ||
<br> | <br> | ||
| + | </center> | ||
| + | '''DNA Measurement Protocol'''<br> | ||
| + | #First, the glass side of the slide was placed faced down onto the device.<br> | ||
| + | #A different pipette was used for transferring each content from the small tubes to the bigger ones.<br> | ||
| + | #After labeling the tubes and pipettes, gloves were worn to ensure a contamination free procedure.<br> | ||
| + | #Using the specific pipette for each component, one drop of buffer was put onto the first and second centered holes of the slide and two drops of diluted sample were placed on the gathered buffer drops.<br> | ||
| + | #Turn on the light and adjust it so that it goes through the drop.<br> | ||
| + | #The device was then put as far back inside the upside down box as possible so that much of the stray light will be removed.<br> | ||
| + | #The phone was placed into the holder inside the box.<br> | ||
| + | #After customizing the photo settings in the phone according to the instruction sheet, a shot of the drop sample was taken and saved.<br> | ||
| + | #The number of the photo was recorded in a table to keep track of the photos.<br> | ||
| + | #The photo was sent to the e-mail of the group member who was responsible for analyzing the photo.<br> | ||
| + | #The previous steps were repeated for each sample with the exception of:<br> | ||
| + | #*Replacing the water drops with the rest of the samples.<br> | ||
| + | #*Using next two consecutive holes on the glass slide each time a sample was used.<br> | ||
| - | ''' | + | '''Open ImageJ'''<br> |
| + | 1. By using a USB cable, connect the camera phone to the desired computer that has already ImageJ installed.<br> | ||
| + | 2. Under my computer, choose portable devices where you could find the smartphone listed; double-click on it.<br> | ||
| + | 3. After localizing the DCIM folder and opening it, you should select camera.<br> | ||
| + | 4. The desired photos can then be transferred by simply putting them into the created folder.<br> | ||
| + | 5. Open ImageJ and go to file; click on it and choose open.<br> | ||
| + | 6. Select browse then pick the desired picture from the same folder created earlier.<br> | ||
| + | 7. To continue opening different pictures, you should only repeat steps 5 and 6.<br> | ||
==Research and Development== | ==Research and Development== | ||
| Line 162: | Line 236: | ||
| - | '''Background on Disease Markers''' | + | '''Background on Disease Markers'''<br> |
| - | + | ||
| - | < | + | |
| + | Parkinson’s Disease is a degenerative disorder in the nervous system where the nerve cells cannot send messages to the muscles adequately due to a lack of dopamine. This usually leads to tremors and a difficulty moving. Typically, Parkinson’s disease develops in person after the age of 50, but it is not always the case. This disease cannot be cured, but it can be treated. | ||
| + | <br> | ||
| + | This disease is generally contracted through genetics. The SNP of this is can be found in SNP cluster report of rs2853826. The error is due to an adenine nucleotide replaced with the guanine.<br><br> | ||
| + | Source:[[ http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=2853826]] | ||
'''Primer Design''' | '''Primer Design''' | ||
| - | + | The reverse primer used: ATTAGACTGA-'''G'''-GGCTTAACCA | |
| + | |||
| + | The forward primer used: TGGTTAAGCCCTCAGTCTAAT | ||
| + | |||
| + | |||
| + | In the case of Parkinson's Disease, the nucleotide adenine, usually denoted by A, has been replaced by the nucleotide guanine, usually denoted by G, as shown in the DNA sequence above. However, the primer only binds to the matching opposite sequence. That is, A only pairs with T, or thymine, and G only pairs with C, or cytosine. Thus, this creates a situation in which the primer is unable to bind to the DNA strand. Since the primer cannot bind to the DNA sequence beyond the point of the nucleotide substitution, the double helix is left disentangled and the reaction cannot occur. This leads to unsuccessful amplification, which means that the results would appear to be negative as they will not be visible. | ||
| + | <br><br> | ||
| + | If the Parkinson's gene is present, then the matching opposite primer will successfully bind to the DNA strand. This will then be visible as a positive result, because of the fact that the attached primer would aid in proceeding the amplification process. | ||
| + | |||
| + | |||
| + | <!--- Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | ||
| Line 178: | Line 264: | ||
'''Illustration''' | '''Illustration''' | ||
| - | + | [[Image:ParkinsonDNAPCR.jpg]] | |
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} | ||
Current revision
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features Instructions
ProtocolsPolymerase Chain Reaction
PCR Protocol
The time for this experiment will be reduced due to the improvements made on the PCR machine. It should cycle much quicker than it did before (about an hour and a half to two hours). How much of a time difference is uncertain.
The Components of the GoTaq® Colorless Master Mix
Volumes Used for Mixture
DNA Samples (8)
DNA Measurement Protocol
Open ImageJ Research and DevelopmentBackground on Disease Markers Parkinson’s Disease is a degenerative disorder in the nervous system where the nerve cells cannot send messages to the muscles adequately due to a lack of dopamine. This usually leads to tremors and a difficulty moving. Typically, Parkinson’s disease develops in person after the age of 50, but it is not always the case. This disease cannot be cured, but it can be treated.
The reverse primer used: ATTAGACTGA-G-GGCTTAACCA The forward primer used: TGGTTAAGCCCTCAGTCTAAT
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



