BME103:T130 Group 13 l2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(OUR TEAM)
(OUR TEAM)
Line 17: Line 17:
| [[Image:BME103student.jpg|100px|thumb|Name: Ujwala Vaka<br>Experimental protocol planner]]
| [[Image:BME103student.jpg|100px|thumb|Name: Ujwala Vaka<br>Experimental protocol planner]]
| [[Image:BME103student.jpg|100px|thumb|Name: Emily Herring<br>Experimental protocol planner]]
| [[Image:BME103student.jpg|100px|thumb|Name: Emily Herring<br>Experimental protocol planner]]
-
| [[Image:BME103student.jpg|100px|thumb|Name: Sudarshan Iyer<br>Research and Design scientist]]
+
| [[Image:BME103student.jpg|100px|thumb|Name: Sudarshan Iyer<br>Research and Development scientist]]
|}
|}

Revision as of 13:02, 16 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Garrett ReppOpen PCR machine engineer
Name: Garrett Repp
Open PCR machine engineer
Name: Joseph RosarioOpen PCR machine engineer
Name: Joseph Rosario
Open PCR machine engineer
Name: Ujwala VakaExperimental protocol planner
Name: Ujwala Vaka
Experimental protocol planner
Name: Emily HerringExperimental protocol planner
Name: Emily Herring
Experimental protocol planner
Name: Sudarshan IyerResearch and Development scientist
Name: Sudarshan Iyer
Research and Development scientist

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features


Instructions





Protocols

Materials


PCR Protocol



DNA Measurement Protocol



Research and Development

Background on Disease Markers

Cystic fibrosis is a disease that can be passed on down genetically along the familial line. The disease causes a build up of thick mucus on the inside of the lungs, digestive tract and other parts of the body. Cystic Fibrosis is the most common chronic lung disease to effect children and young adults and is usually diagnosed by the age of two; however, there are weaker strains of the disease that often go un-diagnosed until the age of 18 or later. The disease is recessive so to suffer the disease one must have the gene from both parents. The disease is life-threatening, the mucus builds up and can eventually suffocate the victim. Around 1 in 29 Caucasians of middle European dissent suffer from cystic fibrosis, this is the most susceptible group to this disease.

One such SNP which signals for a susceptibility to Cystic Fibrosis is the [A/G] swap changing the codon from TGG ⇒ TGA. This change has been recorded in two patients suffering from cystic fibrosis the swap occurs at nucleotide 302 in exon 3 converting codon 57 from TGG (trp) to TGA (stop).

More information can be found: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121909025



Primer Design

The primers must be built around the sequence CGTCTCTAC[T/C]CTATCTCTC with the thymine swapped for the cytosine giving the primers:

Reverse primer: 3' CGTCTCTTACTCTATCTCTC 5'

Forward primer: 5' AAATATCTGGCTGAGTGTTT 3'

These primers are 150 bp apart so as to allow the PCR reaction to occur faster, shortening the 30 seconds required per temperature cycled to 10 seconds per cycle.


Illustration


Personal tools