BME103:T130 Group 12 l2
From OpenWetWare
(→Thermal Cycler Engineering) |
(→Thermal Cycler Engineering) |
||
| Line 43: | Line 43: | ||
'''Instructions''' | '''Instructions''' | ||
| + | |||
'''For the lid design''' | '''For the lid design''' | ||
'''1.''' Remove the knob on the lid | '''1.''' Remove the knob on the lid | ||
| Line 48: | Line 49: | ||
'''3.''' Lower the bottom heating plate to the desired height | '''3.''' Lower the bottom heating plate to the desired height | ||
'''4.''' Lower the higher heating plate so the difference in space between the two plates was similar as before | '''4.''' Lower the higher heating plate so the difference in space between the two plates was similar as before | ||
| + | |||
For the top body part''' | For the top body part''' | ||
'''1.''' Attach the part as you would normally | '''1.''' Attach the part as you would normally | ||
Revision as of 00:15, 29 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||
| | |||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Below is the top part of the general body of the PCR machine. It will be altered so buttons can be placed next to the LED screen. Key Features Design changes on the top body part will include changing the layout so that it may fit input buttons that will be connected and programmed internally later. These buttons will allow an individual to set up cycling details and will remove the need of an external computer to run the device.
For the lid design 1. Remove the knob on the lid 2. Once the knob is removed, the bolt will be able to be removed. 3. Lower the bottom heating plate to the desired height 4. Lower the higher heating plate so the difference in space between the two plates was similar as before For the top body part 1. Attach the part as you would normally 2. Connect the input buttons to the circuit board.
ProtocolsMaterials
A polymerase chain reaction (PCR) is based on the enzyme DNA Polymerase's ability to synthesize complementary DNA strands. Through a series of steps involving polymerase breaking apart a DNA strand and then synthesizing a specified complementary piece, a PCR machine is able to isolate and amplify a desired strand of DNA. Steps to Amplify a Patient's DNA Sample 1. PCR uses controlled temperature changes to make copies of DNA. Heat (about 95°C) separates double-stranded DNA into two single strands; this process is called denaturation. 2. "Primers", or short DNA strands, binds to the very end of the complimentary sequence that is being replicated. This step is called annealing, which takes place between 40°C and 65°C. The temperature that we used was 57°C. 3. Once the annealing process is done, the temperature is raised to about 72°C and DNA polymerase then extends from the primers copying the DNA. 4. PCR then amplifies a segment of a DNA sequence. In the end, there will be two new DNA strands identical to the original strand. Components of PCR Master Mix • A modified form of the enzyme Taq DNA polymerase that lacks 5´→3´ exonuclease activity. • dNTPs • MgCl2 • Colorless Reaction Buffer (pH 8.5)
1. With a permanent marker, number your transfer pipettes at the bulbs so that you only use if for one sample. With the permanent marker number your Eppendorf tubes at the top. 2. Transfer each sample seperatly (using one pipette per sample) into an Eppendorf tube containing 400 mL of buffer. Label this tube with the number of your sample. Get your entire sample into this Eppendorf tube. You can use this sample number transfer pipette to place only this sample drop onto the fluorescent measuring device. 3. Take the specially labeled Eppendorf tube containing Sybr Green I using the specifically labeled pipette only place two drops on the first two centered drops as seen on the video. 4. Now take your diluted sample and place two drops on top of the Syber Green I solution drops. 5. Align the light going through the drop, as seen in the video. 6. After setting up the Flourimeter and the samples set a Smartphone’s photo settings to the ones listed.
7. Place the Flourimeter in the light box. 8. Let the smart-phone operator take as many pictures using the light box as he/she wants. Their goal is to take pictures clear enough so ImageJ can take data from the images. 9. Once they have taken enough photos of that sample give the Flourimeter back to the sample preparer to prepare the next sample. 10. Now either rerun the sample again or discard that sample and it’s pipette. Keep the Sybr Green I labeled pipette. 11. Repeat this procedure for all the samples. You can run 5 samples per glass slide. 12. As the last sample run the water from the scintillation vial as a blank using the same procedure as with the other samples. 14. Collect the INTDEN for your positive and negative controls and your patient samples. 21. Calculate the DNA μg/mL with this equation: 2*INTDEN of sample/INTDEN of DNA Calf Thymus. Research and DevelopmentBackground on Disease Markers Human Immunodeficiency Virus, or HIV is a horrible disease and is running ramped everywhere, especially in underdeveloped countries. There are also many people with HIV in developed countries such as the United States. This disease affects chromosome 17 and the genome build 36.3. After researching the SNP for HIV, which is rs1024611, the mutation in the sequence was discovered to be ATA. So then a primer to be used along side a PCR was developed. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=1024611
The primer that can be used to detect HIV is CGTCTGTCGATAGTGAAAGG and its reverse GCAGACAGCTATCACTTTCC. A diseased allele will only give results because of the way the PCR works and how the primers will attach. If the sample has the disease then the primer will attach to the DNA and as the PCR goes through its cycles there will be a multitude of the same DNA strand with the SNP rs1024611. If the sample does not have the disease allele then there will be no interaction with the DNA and the primer, therefore there will be no change from the original and the end results.
| |||||||||||||||||||||||||||||||||||||||||||||



