BME103:T130 Group 12
From OpenWetWare
(→Research and Development) |
(→Protocols) |
||
| Line 95: | Line 95: | ||
| '''Total Volume'''||100μL | | '''Total Volume'''||100μL | ||
|} | |} | ||
| + | |||
| + | |||
| + | '''Sample 1:''' | ||
| + | Patient ID: 11014 | ||
| + | Age: 67 | ||
| + | Gender: Male | ||
| + | Replicate: 1 | ||
| + | |||
| + | |||
| + | '''Sample 2:''' | ||
| + | Patient ID: 11014 | ||
| + | Age: 67 | ||
| + | Gender: Male | ||
| + | Replicate: 2 | ||
| + | |||
| + | |||
| + | '''Sample 3:''' | ||
| + | Patient ID: 11014 | ||
| + | Age: 67 | ||
| + | Gender: Male | ||
| + | Replicate: 3 | ||
| + | |||
| + | |||
| + | '''Sample 4:''' | ||
| + | Patient ID: 46446 | ||
| + | Age: 62 | ||
| + | Gender: Female | ||
| + | Replicate: 1 | ||
| + | |||
| + | |||
| + | '''Sample 5:''' | ||
| + | Patient ID: 46446 | ||
| + | Age: 62 | ||
| + | Gender: Female | ||
| + | Replicate: 2 | ||
| + | |||
| + | |||
| + | '''Sample 6:''' | ||
| + | Patient ID: 46446 | ||
| + | Age: 62 | ||
| + | Gender: Female | ||
| + | Replicate: 3 | ||
| + | |||
| + | |||
| + | '''Sample 7:''' | ||
| + | Positive Control | ||
| + | |||
| + | |||
| + | '''Sample 8:''' | ||
| + | Negative Control | ||
| + | |||
| + | |||
| + | |||
'''Flourimeter Measurements'''<br> | '''Flourimeter Measurements'''<br> | ||
| Line 100: | Line 153: | ||
[[Image:Flourimeter1.jpg]]A drop of water on hydrophobic slide | [[Image:Flourimeter1.jpg]]A drop of water on hydrophobic slide | ||
| + | |||
| + | [[Image:flourimeter2.JPG]]Proper assembly of the flourimeter. | ||
Revision as of 18:55, 1 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||
| | ||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Open PCR machines is a DYI device that is composed of many circuit boards, wires, and a wooden frame. It is to be used to cycle DNA by oscillating the temperature of the DNA samples. This machine predominately works when the samples are placed in the main heating block, at which point a heated lid is placed down on top of the samples. Once the software for this Open PCR device is set up, the temperature change and the actual process begins. Within the Open PCR machine is a multitude of parts that keep the machine intact. These parts include a heat sink and fan to absorb heat, a circuit board that runs all the parts, a power supply to maintain the electricity, and a LCD display to show the user information. In conclusion, all of these parts work cohesively to generate this working machine known as the Open PCR. Experimenting With the Connections It is important to note that the LCD display will not work if it is not connected to the Open PCR circuit Board. Also, the temperature will not be shown on the LCD display if the white wire connecting to the main heating block is disconnected from the Open PCR circuit board.
(Write the date you first tested Open PCR and your experience(s) with the machine)
ProtocolsPolymerase Chain Reaction A polymerase chain reaction (PCR) is based on the enzyme DNA Polymerase's ability to synthesize complementary DNA strands. Through a series of steps involving polymerase breaking apart a DNA strand and then synthesizing a specified complementary piece, a PCR machine is able to isolate and amplify a desired strand of DNA.
Steps to Amplify a Patient's DNA Sample 1. This is step 1 2. This is where step 2 will go 3. Здравствуйте! 4. And step 4 is not in Russian
Components of PCR Master Mix • A modified form of the enzyme Taq DNA polymerase that lacks 5´→3´ exonuclease activity. • dNTPs • MgCl2 • Colorless Reaction Buffer (pH 8.5)
Components of PCR Master Mix
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”. If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal.
Source: http://openpcr.org/use-it/
Results(Your group will add the results of your Fluorimeter measurements from Week 4 here)
| ||||||||||||||||||||||




