BME103:T130 Group 12
From OpenWetWare
(→OUR TEAM) |
(→Protocols) |
||
| Line 99: | Line 99: | ||
[[Image:Flourimeter1.jpg]]A drop of water on hydrophobic slide | [[Image:Flourimeter1.jpg]]A drop of water on hydrophobic slide | ||
| + | |||
| + | |||
| + | |||
| + | '''Flourimeter Assembly Procedure''' | ||
| + | |||
| + | |||
| + | Hey Chiao, can you do these procedures? | ||
| + | |||
| + | |||
| + | '''Procedure for Opening Images in ImageJ''' | ||
| + | |||
| + | |||
| + | This is where the procedure goes | ||
Revision as of 18:38, 1 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||
| | ||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Open PCR machines is a DYI device that is composed of many circuit boards, wires, and a wooden frame. It is to be used to cycle DNA by oscillating the temperature of the DNA samples. This machine predominately works when the samples are placed in the main heating block, at which point a heated lid is placed down on top of the samples. Once the software for this Open PCR device is set up, the temperature change and the actual process begins. Within the Open PCR machine is a multitude of parts that keep the machine intact. These parts include a heat sink and fan to absorb heat, a circuit board that runs all the parts, a power supply to maintain the electricity, and a LCD display to show the user information. In conclusion, all of these parts work cohesively to generate this working machine known as the Open PCR. Experimenting With the Connections It is important to note that the LCD display will not work if it is not connected to the Open PCR circuit Board. Also, the temperature will not be shown on the LCD display if the white wire connecting to the main heating block is disconnected from the Open PCR circuit board.
(Write the date you first tested Open PCR and your experience(s) with the machine)
ProtocolsPolymerase Chain Reaction A polymerase chain reaction (PCR) is based on the enzyme DNA Polymerase's ability to synthesize complementary DNA strands. Through a series of steps involving polymerase breaking apart a DNA strand and then synthesizing a specified complementary piece, a PCR machine is able to isolate and amplify a desired strand of DNA.
Steps to Amplify a Patient's DNA Sample 1. This is step 1 2. This is where step 2 will go 3. Здравствуйте! 4. And step 4 is not in Russian
Components of PCR Master Mix • A modified form of the enzyme Taq DNA polymerase that lacks 5´→3´ exonuclease activity. • dNTPs • MgCl2 • Colorless Reaction Buffer (pH 8.5)
Components of PCR Master Mix
Flourimeter Measurements
Flourimeter Assembly Procedure
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology PCR detection works by heating the DNA sample to about 110oC in order to split the DNA. Then the PCR cools off to 57oC in order for the primer to attach to the DNA strands. The PCR then heats to 72oC so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”. If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal. (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)
Results(Your group will add the results of your Fluorimeter measurements from Week 4 here)
| ||||||||||||||||||||||




