BME103:T130 Group 12

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Justin Landstrom Experimental Protocol Planner Name: Chiao May Lee Experimental Protocol Planner Name: James Kyeh Machine Engineer Name: Jakob G. Wells R&D Scientist Name: Heidi Hall Machine Engineer Name: student Role(s) LAB 1 WRITE-UP Initial Machine Testing The Original Design The Open PCR machines is a DYI device that is composed of many circuit boards, wires, and a wooden frame. It is to be used to cycle DNA by oscillating the temperature of the DNA samples. This machine predominately works when the samples are placed in the main heating block, at which point a heated lid is placed down on top of the samples. Once the software for this Open PCR device is set up, the temperature change and the actual process begins. Within the Open PCR machine is a multitude of parts that keep the machine intact. These parts include a heat sink and fan to absorb heat, a circuit board that runs all the parts, a power supply to maintain the electricity, and a LCD display to show the user information. In conclusion, all of these parts work cohesively to generate this working machine known as the Open PCR. Experimenting With the Connections It is important to note that the LCD display will not work if it is not connected to the Open PCR circuit Board. Also, the temperature will not be shown on the LCD display if the white wire connecting to the main heating block is disconnected from the Open PCR circuit board. Test Run (Write the date you first tested Open PCR and your experience(s) with the machine) Protocols Polymerase Chain Reaction A polymerase chain reaction (PCR) is based on the enzyme DNA Polymerase's ability to synthesize complementary DNA strands. Through a series of steps involving polymerase breaking apart a DNA strand and then synthesizing a specified complementary piece, a PCR machine is able to isolate and amplify a desired strand of DNA. Steps to Amplify a Patient's DNA Sample 1. PCR uses controlled temperature changes to make copies of DNA. Heat (about 95°C) separates double-stranded DNA into two single strands; this process is called denaturation. 2. "Primers", or short DNA strands, binds to the very end of the complimentary sequence that is being replicated. This step is called annealing, which takes place between 40°C and 65°C. The temperature that we used was 57°C. 3. Once the annealing process is done, the temperature is raised to about 72°C and DNA polymerase then extends from the primers copying the DNA. 4. PCR then amplifies a segment of a DNA sequence. In the end, there will be two new DNA strands identical to the original strand. Components of PCR Master Mix • A modified form of the enzyme Taq DNA polymerase that lacks 5´→3´ exonuclease activity. • dNTPs • MgCl2 • Colorless Reaction Buffer (pH 8.5) Components of PCR Master Mix Reagent Volume Template DNA (20 ng) 0.2μL 10μM forward primer 1.0μL 10μM reverse primer 1.0μL GoTaq master mix 50.0μL dH2O 47.8μL Total Volume 100μL Sample 1: Patient ID: 11014 Age: 67 Gender: Male Replicate: 1 Sample 2: Patient ID: 11014 Age: 67 Gender: Male Replicate: 2 Sample 3: Patient ID: 11014 Age: 67 Gender: Male Replicate: 3 Sample 4: Patient ID: 46446 Age: 62 Gender: Female Replicate: 1 Sample 5: Patient ID: 46446 Age: 62 Gender: Female Replicate: 2 Sample 6: Patient ID: 46446 Age: 62 Gender: Female Replicate: 3 Sample 7: Positive Control Sample 8: Negative Control Flourimeter Measurements A drop of water on hydrophobic slide Proper assembly of the flourimeter. Flourimeter Assembly Procedure 1. To assemble the flourimeter, first obtain smartphone to capture the picture needed during data collection. 2. Turn on the flourimeter and drop a single drop of solution onto the hydrophobic slide. 3. Turn the black box provided upside down to cover the flourimeter. 4. Set up the smartphone on the stand provided, and aligned the camera/phone in 3 inches in front of the flourimeter. Make sure that the stand and the flourimeter is covered directly under the black box. Procedure for Opening Images in ImageJ 1. ImageJ was used to analyze the images taken by the smartphone. To upload the image onto ImageJ, click the ANALYZE tab and choose SET MEASUREMENTS. Select AREA INTEGRATED DENSITY and MEAN GREY VALUE. 2. Research and Development Specific Cancer Marker Detection - The Underlying Technology PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”. If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal. http://openwetware.org/images/3/39/Screen_Shot_2012-11-01_at_3.56.31_PM.png Source: http://openpcr.org/use-it/ Results (Your group will add the results of your Fluorimeter measurements from Week 4 here)