BME103:T130 Group 11 l2: Difference between revisions
Line 43: | Line 43: | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
Critical features to our design include an increase in tube space from 16 tube slots to 96. In doing this, the area of the heating plate is increased relative to the space the tubes take up. The increased area of the heating plate will require added ventilation to speed up the cooling process. The increased heating plate is necessary, because the PCR requires a series of heating up and cooling down the DNA to specific temperatures so that the DNA will multiply. | Critical features to our design include an increase in tube space from 16 tube slots to 96. In doing this, the area of the heating plate is increased relative to the space the tubes take up. The increased area of the heating plate will require added ventilation to speed up the cooling process. The increased heating plate is necessary, because the PCR requires a series of heating up and cooling down the DNA to specific temperatures so that the DNA will multiply. | ||
The benefits of increasing the tube space would be that the PCR would be more efficient. It would be more efficient because the Machine would be able to test more subjects at the same rate, allowing for increased amount of trials and increased amount of patients. | The benefits of increasing the tube space would be that the PCR would be more efficient. It would be more efficient because the Machine would be able to test more subjects at the same rate, allowing for increased amount of trials and increased amount of patients. This product would be more effective in a lab or clinic that performs mass testing for diseases. | ||
Revision as of 20:23, 27 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
In order to increase tube space, we increase the heating plate and increase the power proportionally to the size of the plate. We would also add more ventilation next to the heating plate in order to speed up the cooling process of the DNA. Key Features
ProtocolsMaterials
PCR Protocol
Research and DevelopmentCystic Fibrosis is a genetically inherited disease that is derived from the production of excessive mucous build up in the respiratory tract. This has a major effect on the body's endocrine system, more specifically in the digestive and respiratory systems.
More information on the gene can be found at http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35731153
The forward primer for this disease would be CAGTCGCAGACGGAGAGGCAT while the reverse primer for without the disease would be GTCAGCGTCTCCCTCTCCGTA. If the patient was positive for the cystic fibrosis mutation, the reverse primer would be GTCAGCGTCTGCCTCTCCGTA. The difference between the mutation and the normal strand is that the normal strand has the allele TCC where the mutation has TGC. So the C and the G is changed. When the primer is made and put into the PCR machine, it will only attach to the mutation strands. If the primer matches up, it will glow under a black light therefore indicating that the patient has the disease. If there is no glow, that means the patient does not have that type of cystic fibrosis.
Illustration
|