BME103:T130 Group 10
From OpenWetWare
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||
| | ||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design Experimenting With the Connections When the circuit board (part 6) was unplugged from the display (part 3), the display turned off and no longer registered any signal. The display was no longer functional, but turned on again once the wire between the two parts was reconnected. When the circuit board was unplugged from the heating element, the heating element was no longer able to control its temperature. Although it still had power, it was not being controlled by the circuit board.
The first test run completed on the OpenPCR machine was on October 25, 2012. The test was successful, and was completed in roughly the time expected, give or take a few minutes. Once the settings were put to the correct levels, the set up was quite simple. The samples were placed inside the heating unit, then the test run started. It took over an hour, but was completed successfully with no malfunctioning pieces of equipment.
ProtocolsPolymerase Chain Reaction 1.)HOW PCR WORKS The Polymerase Chain Reaction machine, PCRm for short, works by cycling DNA through different temperatures to amplify the desired strand so the sample can be compared with other DNA. First, the DNA is denatured by heating the samples to such temperature that the hydrogen bonds holding the double-stranded molecule together are broken. The sample is then cooled, which allows a primer to bind to the target DNA. In the third step, the sample is heated back up so an enzyme can replicate the DNA. In the final step, a fluorescent dye binds to the new double-stranded DNA. This process is repeated many times, amplifying the target strand to an analyzable quantity. 2.)STEPS TO AMPLIFY DNA The actual steps for PCR are quite simple. Step 1. The PCRm lid is heated to 100°C and the sample tubes are heated to 95°C. This temperature is held constant for 3 minutes. Step 2. The PCRm is then set to run 30 consecutive temperature cycles. Each cycle consists of heating the sample to 95°C for 30 seconds, cooling to 57°C for 30 seconds, and finally, heating to 72°C for 30 seconds. Step 3. After the series of cycles is completed, the PCRm temperature is then held at 72°C for 3 minutes. Step 4. The PCRm is then kept constant at 4°C 3.)COMPONENTS OF PCR MIX 4.)TABLE OF REAGENTS AND VOLUMES USED 5.)SAMPLE DESCRIPTIONS
1.)PHOTO OF SETUP 2.)STEPS TO ASSEMBLE THE FLUORIMETER To assemble the fluorimeter, there are a few easy steps that need to be followed. The first step is to unbutton the front flaps and open the lid. Take out the interior contents which include the slide that the sample is put on and the cell phone stand. Once this is done, close the lid so that only the front is open. Place your sample on the slide, turn on the light and place the entire ensemble inside the box. Then put a cell phone with a camera in the cell phone stand. Align the camera with the sample on the slide. After this step, the fluorimeter is set up. Refer to the image above for a photo of the set up. 3.)USING IMAGE J We used the program ImageJ to analyze our results. In ImageJ, we first opened the photograph taken using the fluorimeter setup. We then split the photograph into color channels (IMAGE -> COLOR -> SPLIT CHANNELS) in order to separate the "green" of the image from the overall photograph. The SYBRGreen's fluorescence can be analyzed with any expectation of validity only in isolation. The blue and red channel images were disgarded. Before actually measuring the image, we set the desired parameters of measurement (ANALYZE -> SET MEASUREMENTS -> AREA, INTEGRATED DENSITY, MEAN GRAY VALUE). Then, using the "oval" tool, we selected the sample solution in the image. After selecting the sample, we measured for the selected data (ANALYZE -> MEASURE) and recorded the results. Without changing the shape of the selected area, we dragged the oval to be in the background of the image and repeated the measurements. The background numbers are needed to accurately calculate how much of the sample measurements are actually attributed to the sample and not simply the image itself. We repeated this entire process for each photographed sample.
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology This exercise primarily uses the Polymerase Chain Reaction (PCR) method to replicate and amplify explicit DNA sequences that could be used to identify susceptibility to cancer and other diseases. During the process, this experiment uses a combination of a sample of Template DNA, DNA Primers, Taq Polymerase and thermocycling preformed by a PCR machine. After combining the sample DNA and chemicals, the sample tubes are placed into the OpenPCR machine where they will undergo the amplification process. The PCR process begins by heating the samples to break apart the matched strands of DNA. The result is two separate DNA molecules. The PCR machine then reduces the temperature in order to allow the pre-specified primers to bind to the intended region on the strand of DNA. After reheating the sample solution, Taq Polymerase is able to take base pairs and re-synthesize the paired strands. The process is repeated a total of 30 to 35 times, but by the third heat cycle we are able to produce the specific DNA sequence without any extra sequences. The specific rs17879961[1] used in our exercise has been related to Breast Cancer, Li-Fraumeni syndrome and other cancers [2]. The rs17879961 is a mutation specific to the CHEK2 gene, which relates to a cell's ability to fix DNA when any damage occurs. The rs17879961 mutation would allow for increased susceptibility to cancer. In the field, PCR and the use of the specific primers would allow for the rapid replication of the the gene, should the mutation be present. However, if the mutation did not exist in the patient the replication would occur on a significantly smaller scale. Example Animation Primer Development Mutation: GGAAGTGGGTCCTAAAAACTCTTACA [C] TGCATACATAGAAGATCACAGTGGC Forward Primer: CCTTCACCCAGGATTTTTGAG Backward Primer: ATGTATCTTCTAGTGTCACCG Bayes Rule (A test of Reliability) Bayes Rule allows us to calculate the probability that a positive result actually has cancer present in the patient
Results
| ||||||||||||||||||||||||||||||||||||||||||||||||||



