BME103:T130 Group 10

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Jeffery Ramirez Role: Protocol Planner Name: Tyler Tamasauckas Role: R&D Specialist Name: Alexander Baldwin Role: Open PCR Machine Engineer Name: Frances Lakers Role: R&D Specialist; Data Analyzer Name: student Role(s) LAB 1 WRITE-UP Initial Machine Testing The Original Design (Add image of the full OpenPCR machine here, from the Week 3 exercise. Write a paragraph description for visitors who have no idea what this is) The OpenPCR machine is designed to isolate and replicate certain sequences of DNA through heating and cooling the samples. There are several parts to it, most of which can only be seen if one of the outside walls is taken out. The samples of DNA are placed in small tubes and are then placed in the heating area, where they are repeatedly heated and cooled during several cycles to achieve the desired result. The time for a cycle is usually a few minutes, and there are usually several cycles in a run, so it may last over an hour. Experimenting With the Connections When the circuit board (part 6) was unplugged from the display (part 3), the display turned off and no longer registered any signal. The display was no longer functional, but turned on again once the wire between the two parts was reconnected. When the circuit board was unplugged from the heating element, the heating element was no longer able to control its temperature. Although it still had power, it was not being controlled by the circuit board. Test Run The first test run completed on the OpenPCR machine was on October 25, 2012. The test was successful, and was completed in roughly the time expected, give or take a few minutes. Once the settings were put to the correct levels, the set up was quite simple. The samples were placed inside the heating unit, then the test run started. It took over an hour, but was completed successfully with no malfunctioning pieces of equipment. Protocols Polymerase Chain Reaction 1.)HOW PCR WORKS The Polymerase Chain Reaction machine, PCRm for short, works by cycling DNA through different temperatures to amplify the desired strand so the sample can be compared with other DNA. First, the DNA is denatured by heating the samples to such temperature that the hydrogen bonds holding the double-stranded molecule together are broken. The sample is then cooled, which allows a primer to bind to the target DNA. In the third step, the sample is heated back up so an enzyme can replicate the DNA. In the final step, a fluorescent dye binds to the new double-stranded DNA. This process is repeated many times, amplifying the target strand to an analyzable quantity. 2.)STEPS TO AMPLIFY DNA The actual steps for PCR are quite simple. Step 1. The PCRm lid is heated to 100°C and the sample tubes are heated to 95°C. This temperature is held constant for 3 minutes. Step 2. The PCRm is then set to run 30 consecutive temperature cycles. Each cycle consists of heating to 95°C for 30 seconds, cooling to 57°C for 30 seconds, and finally, heating to 72°C for 30 seconds. Step 3. After the series of cycles is completed, the PCRm temperature is then held at 72°C for 3 minutes. Step 4. The PCRm is then kept constant at 4°C 3.)COMPONENTS OF PCR MIX 4.)TABLE OF REAGENTS AND VOLUMES USED 5.)SAMPLE DESCRIPTIONS Fluorimeter Measurements 1.)PHOTO OF SETUP 2.)STEPS TO ASSEMBLE THE FLUORIMETER To assemble the Fluorimeter, there are a few easy steps that need to be followed. The first step is to unbutton the front flaps and open the lid. Take out the interior contents which include the slide that the liquid is put on and the cell phone stand. Once this is done, close the lid so that only the front is open. Place your liquid on the slide, turn on the light and place it inside the box. Then put a cell phone with a camera in the cell phone stand. Align the camera with the drop of liquid on the slide. After this step, the Fluorimeter is set up. Refer to the image above for a photo representation of the set up. 3.)USING IMAGE J Research and Development Specific Cancer Marker Detection - The Underlying Technology This exercise primarily uses the Polymerase Chain Reaction (PCR) method to replicate and amplify explicit DNA sequences that could be used to identify susceptibility to cancer and other diseases. During the process, this experiment uses a combination of a sample of Template DNA, DNA Primers, Taq Polymerase and a heating process preformed by a PCR machine. After combining the sample DNA and chemicals, the sample tubes are placed into the OpenPCR machine where they will undergo the heating process. The PCR process begins by heating the samples to break apart the matched pairs of DNA, the result is two separate DNA molecules. The PCR machine then reduces the temperature in order to allow the pre-specified primers to bind to the intended region on the strand on DNA. Taq Polymerase is now able to take the base pairs and re-synthesize the paired strands. The process is repeated a total of 30 to 35 times, but by the third heat cycle we are able to produce the specific DNA sequence without any extra sequences. The specific rs17879961[1] used in our exercise has been related to Breast Cancer, Li-Fraumeni syndrome and other cancers [2]. The rs17879961 is a mutation specific to the CHEK2 gene, which relates to cells ability to fix DNA when any damage should occur. The rs17879961 mutation would allow for increased susceptibility to cancers. In the field, PCR and the use of the specific primers would allow for the rapid replication of the the gene, should the mutation be present. However, if the mutation did not exist in the patient the replication would occur on a significantly smaller scale. Primer Development GGAAGTGGGTCCTAAAAACTCTTACA [C/T] TGCATACATAGAAGATCACAGTGGC Forward Primer: CAGGATTTTTGTGAATGTGAG Backward Primer: CACTGCATACATAGAAGATCA Bayes Rule (A test of Reliability) Bayes Rule allows us to calculate the probability that a positive result actually has cancer present in the patient [math]\displaystyle{ P(A|B) = \frac{P(B | A)\, P(A)}{P(B)} \, }[/math] (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) Results Sample Integrated Density DNA μg/mL Conclusion PCR: Negative Control E6 F6 G6 PCR: Positive Control E7 F7 G7 PCR: Patient 1 ID #####, rep 1 E8 F8 G8 PCR: Patient 1 ID #####, rep 2 E9 F9 G9 PCR: Patient 1 ID #####, rep 3 E10 F10 G10 PCR: Patient 2 ID #####, rep 1 E11 F11 G11 PCR: Patient 2 ID #####, rep 2 E12 F12 G12 PCR: Patient 2 ID #####, rep 3 E13 F13 G13 KEY Sample = Integrated Density = DNA μg/mL = Conclusion =