BME100 s2015:Group4 9amL5

BME 100 Spring 2015	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Measho Habtemichael Name: student Name: student Name: student Name: Amanda Nguyen LAB 5 WRITE-UP Procedure Smart Phone Camera Settings Type of Smartphone: Samsung Galaxy S5 Flash: OFF ISO setting: 800 White Balance: AUTO Exposure: +2.0 Saturation: N/A Contrast: N/A Calibration Distance between the smart phone cradle and drop = 5 cm Solutions Used for Calibration initial concentration of 2X calf thymus DNA solution (micrograms/mL) volume of the 2X DNA solution (microliters) Volume of the SYBR GREEN I Dye solution (microliters) Final DNA concentration in SYBR Green I solution (micrograms/mL) 5 80 80 2.5 2 80 80 1 1 80 80 0.5 0.5 80 80 0.125 0.25 80 80 0.125 0 80 80 0 Placing Samples onto the Fluorimeter In the center of the first two rows of the slide, put 80 microliters of SYBR GREEN I Ensure that the drop is centered Add 80 micrometers of water Move the slide so that the drop is aligned and focused by the blue LED to the middle of the black fitting opposite the drop Cover the drop with the light box Use the timer take a picture of the drop Take three images of the focused drop Remove the box Remove the sample using the pipettor Repeat steps for next 5 samples Data Analysis Representative Images of Negative and Positive Samples Image J Values for All Calibrator Samples TABLE GOES HERE Calibration curve PCR Results Summary Our positive control PCR result was ____ μg/mL Our negative control PCR result was ____ μg/mL Observed results Patient _____ : Patient _____ : Conclusions Patient _____ : Patient _____ : SNP Information & Primer Design Background: About the Disease SNP SNP is a DNA sequence that is associated with coronary heart and artery disease. Primer Design and Testing In the first part of designing the primers, it was necessary to validate the two non-disease primers that were designed using the instructions from the lab workbook. The non-disease forward primer was composed of 20 nucleotides that ended with the SNP from the top strand of DNA. These nucleotides were recorded reading left to right. The last nucleotide of the sequence was at position 19956018, which is the position of the position of the SNP. In order to find the non-disease reverse primer, the position 200 bases to the right of the disease SNP was used. The bases were taken from the second, bottom strand of DNA, read left to right, starting at the 19956218 position, 200 bases to the right from the disease SNP base. The bases were recorded until there was a total of 20 bases. The primers tested were as follows. Non-disease forward primer: AATCTGGGCTATGAGATCAA Non-disease reverse primer: GAAACACCAGGGCTCAGGGT This is the information inputted into the UCSC In-Silico PCR website These are the results of the input. From the results, it can be seen that there is a 220 bp sequence from chromosome 8, the same chromosome the SNP, rs268, is found on. This confirms that these are the forward and reverse primers found on this chromosome in a non-disease genome. Then in the second part of designing, disease forward and reverse primers were created. The final base of the non-disease forward primer was changed from A to G, which is the disease SNP base. The disease reverse primer was found using the second, bottom strand of DNA, beginning with the base in the same position as the SNP, and then completed recording the bases left to right until there were a total of 20 bases to compose the primer. The primers tested were as follows: Disease forward primer: AATCTGGGCTATGAGATCAG Disease reverse primer: TTAGACCCGATACTACTAGTT This is the information inputted into the website These are the results of the input From the results, it can be seen that there are no matches to these primers. This is because they are being tested using a non-disease human genome sequence. The disease primers are being compared against a genome that do not have disease.