BME100 s2015:Group13 12pmL5

BME 100 Spring 2015	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Tina Monteilh Name: Payson Wallach Name: Riley Baranek Name: Trisha Dasgupta File:RobelOkbe.jpg Name: Robel Okbe LAB 5 WRITE-UP Procedure Smart Phone Camera Settings Type of Smartphone: Iphone 6 Flash: no flash used ISO setting:was not adjusted White Balance: was not adjusted Exposure: time: 1/15 of a second Saturation:was not adjusted Contrast: highest contrast available Calibration The camera (iPhone 6) was set up horizontally in front of the fluorimeter, and was placed in the cradle after the camera was adjusted according to the settings listed above. After adjustment, the image was checked to make sure that it was not blurry. The fluorimeter was raised up using one stack, in order to make sure the camera captured the best image possible, and the phone was placed 6.5 cm away from the fluorimeter. Distance between the smart phone cradle and drop = 6.5 cm Solutions Used for Calibration Initial Concentration of 2X Calf Thymus DNA solution (micrograms/mL) Volume of the 2X DNA solution (μL) Volume of the SYBR GREEN I Dye solution (μL) Final DNA concentration in SYBR GREEN I solution (μL/mL) 5 80 80 2.5 2 80 80 1 1 80 80 0.5 0.5 80 80 0.25 0.25 80 80 0.125 0 80 80 0 Placing Samples onto the Fluorimeter Using the mircopipette, place 80μL of the SYBR GREEN I onto the slide in between the first two rows, then add 80μL of of one of the concentrations of calf thymus from the table on top of the first drop of SYBR GREEN I so that one large drop is formed Make sure the drop is alighned so that the blue LED light is shining through the large drop Set the timer on the camera being used, and place the cover on the lightbox to make sure that the picture is taken with little to no light shining through Make sure to take 3 focused images of the drop Set the micropipette to 160μL and remove the large drop from the slide, before moving the slide to the next position Repeat steps 1-4 for the rest of the concentrations from the table Data Analysis Representative Images of Negative and Positive Samples Image J Values for All Calibrator Samples TABLE GOES HERE Calibration curve PCR Results Summary Our positive control PCR result was ____ μg/mL Our negative control PCR result was ____ μg/mL Observed results Patient _____ : Patient _____ : Conclusions Patient _____ : Patient _____ : SNP Information & Primer Design Background: About the Disease SNP What is a nucleotide? The organic base units of DNA and RNA What is a polymorphism? A point mutation that is expressed in multiple forms within a population. What species is this variation found in? (latin name) Homo Sapien What chromosome is the variation located on? 8 What is listed as the Clinical significance of this SNP? It is contained within a pathogenic allele Which gene(s) is this SNP associated with? LPL Click the PubMed link to view summaries of research associated with the SNP. What disease is linked to this SNP? Coronary heart disease What does LPL stand for? Lipoprotein Lipase What is the function of LPL? To find out, click the LPL link. Look for “Gene ontology” in the right hand list and click it. Write the first three unique terms you see... apolipoprotein binding heparin binding lipoprotein lipase activity What is an allele? A variation in a gene The disease-associated allele contains what sequence? aat The numerical position of the SNP is 19956018 Non-disease forward primer (20 nt): aatctgggctatgagatcaa The numerical position exactly 200 bases to the right of the disease SNP is: 19956218 Non-disease reverse primer (20 nt): gaaacaccagggctcagggt Disease forward primer (20 nt): aatctgggctatgagatcag Disease reverse primer (20 nt): gaaacaccagggctcagggt Primer Design and Testing