DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes
have the same forward primer and reverse primer
A strip of empty PCR tubes
Disposable pipette tips: only use each only once. Never re-use disposable pipette tips or
samples will be cross-contaminated
Cup for discarded tips
Micropipettor
OpenPCR machine: shared by two groups
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G13 +
Positive control
none
G13 -
Negative control
none
G13 1-1
Patient 1, replicate 1
21533
G13 1-2
Patient 1, replicate 2
21533
G13 1-3
Patient 1, replicate 3
21533
G13 2-1
Patient 2, replicate 1
45821
G13 2-2
Patient 2, replicate 2
45821
G13 2-3
Patient 2, replicate 3
45821
DNA Sample Set-up Procedure
Step 1
Step 2
Step 3...
OpenPCR program
HEATED LID: 100°C
INITIAL STEP: 95°C for 2 minutes
NUMBER OF CYCLES: 35
Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30
seconds
FINAL STEP: 72°C for 2 minutes
FINAL HOLD: 4°C
Research and Development
PCR - The Underlying Technology
Q1
Template DNA is used to make the complementary strand. Primers are used to help copy the DNA by attaching to sites on the DNA strands that are at either end of the segment that needs to be copied. Taq polymeraseis an enzyme that assembles new DNA from nucleotides. Deoxyribonucleotides (dNTPs) are the building blocks from which the DNA polymerase (Taq polymerase) uses to make the new DNA strand.
Q2
Initial step: 95 degrees Celsius for 3 minutes- Heats up all of the components
Denature at 95 degrees Celsius for 30 seconds-The template DNA experiences DNA melting which makes single-stranded DNA
Anneal at 57 degrees Celsius for 30 seconds- allows the primers to attach to the single stranded DNA template
Extend at 72 degrees Celsius for 30 seconds- Taq polymerase is at is optimum activity level at this temperature. The taq polymerase is able to assemble a new strand of DNA along with a complementary strand using the deoxyribonucleotides.
FINAL STEP-72 degrees Celsius for 3 minutes- this makes sure that all of the single-stranded DNA was extended.
FINAL HOLD: 4 degrees Celsius-used for short-term storage of the reaction.
Q3
Adenine pairs with Thymine while Cytosine pairs with Guanine.
Q4
What is a nucleotide? The organic base units of DNA and RNA
What is a polymorphism? A point mutation that is expressed in multiple forms within a population.
What species is this variation found in? (latin name) Homo Sapien
What chromosome is the variation located on? 8
What is listed as the Clinical significance of this SNP? It is contained within a pathogenic allele
Which gene(s) is this SNP associated with? LPL
Click the PubMed link to view summaries of research associated with the SNP. What disease is linked to this SNP? Coronary heart disease
What does LPL stand for? Lipoprotein Lipase
What is the function of LPL? To find out, click the LPL link. Look for “Gene ontology” in the right hand list and click it. Write the first three unique terms you see...
apolipoprotein binding
heparin binding
lipoprotein lipase activity
What is an allele? A variation in a gene
The disease-associated allele contains what sequence? aat
The numerical position of the SNP is 19956018
Non-disease forward primer (20 nt): aatctgggctatgagatcaa
The numerical position exactly 200 bases to the right of the disease SNP is: 19956218
Non-disease reverse primer (20 nt): gaaacaccagggctcagggt
Disease forward primer (20 nt): aatctgggctatgagatcag
Disease reverse primer (20 nt): gaaacaccagggctcagggt
Primer Design and Testing