BME100 s2014:W Group9 L6: Difference between revisions
Line 52: | Line 52: | ||
* Reverse Primer: ''5'CGTAAGAGTTAATCTTGTGA'' | * Reverse Primer: ''5'CGTAAGAGTTAATCTTGTGA'' | ||
<br> | <br> | ||
'''How the primers work: ''' | '''How the primers work: ''' The forward primer is disease sequence specific. It contains twenty bases, ending with the first nucleotide from the disease-associated allele. Because the primer ends with the disease nucleotide 'A' rather than the non-diseased 'G', only DNA sequences with the disease will be able to replicate. The reverse primer is not disease specific. It is also twenty bases long and ends 200 bases after the forward primer. | ||
==Feature 2: Consumables Kit== | ==Feature 2: Consumables Kit== |
Revision as of 11:01, 16 April 2014
BME 100 Spring 2014 | Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | |
Xtreme DNA
LAB 6 WRITE-UPComputer-Aided DesignTinkerCAD [Instructions: A short summary (up to five sentences) of the TinkerCAD tool and how you used it in lab on November 20th]
Feature 1: Disease SNP-Specific PrimersBackground on the cancer-associated mutation The single nucleotide polymorphism rs237025 is found in the human chromosome 6:149721690. A sequence of alleles is changed from 'GTG' to 'ATG'. This variation occurs in the gene SUM04. This gene is responsible for encoding ubiquitin-related modifiers. These modifiers attach themselves to proteins to control activity, stability, and/or localization. Changing just that one small allele can cause effects with rheumatoid arthritis or type 1 diabetes.
Primer design
Feature 2: Consumables Kit[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness(es), explain how in an additional paragraph.]
Feature 3: Hardware - PCR Machine & Fluorimeter[Instructions: Summarize how you will include the PCR machine and fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine and/or Fluorimeter to address any major weakness(es), explain how in an additional paragraph.]
Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]
|