BME100 s2014:W Group2 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Marshall Treleven Name: Carilee Farrell Name: Roger Rose Name: Marianne Alnimiri Name: Joel Larson Straton Oakmont Inc. LAB 6 WRITE-UP Computer-Aided Design TinkerCAD The TinkerCAD tool is a comprehensive Computer-Aided Design system that allows for ease of use and complex 3 dimensional designs. The CAD is used for a variety of purposes, but the main purpose is 3D Printing. For the lab, We used TinkerCAD to construct our redesigned Open PCR apparatus. Our Design Our design is more of an expansion of the existing apparatus. To it we added a timer in order to indicate when each step of the process has concluded. An external LED display was added for greater interface control. Also, an internal processing unit was added in order to remove the need of an external computer to analyze the data and run the reaction autonomously. We chose this design to further expand the usages of the Open PCR apparatus. Feature 1: Disease SNP-Specific Primers Background on the cancer-associated mutation Nucleotides are the basic building blocks of nucleic acids. A polymorphism is when different phenotypes exist in the same population independent of sexual variations. The SNP variation rs237025 is found in homo sapiens and is located on chromosome 6. The SNP is associated with the genes TAB2 and SUM04 (small ubiquitin-related modifier 4) which modifies IKBA. Diseases linked to this SNP include coronary artery disease as well as type II diabetes. An allele is the alternative form of a gene for a character producing different effects. The disease- associated allele contains the sequence ATG. Primer design Disease SNP-specific Forward Primer: 5’ GTGAAGCAGATCAGATTCCGA Reverse Primer: 5’ AGTTTTCTAATTGAGAATGCA How the primers work: Based on the way the disease-specific primer is designed, the forward primer will bind 100% to a complementary disease-SNP-containing template (from a patient sample). The reverse primer will bind 100% to its complementary template. If either primer cannot bind 100% to a template, PCR cannot occur. PCR will not occur if there is the non-diseased allele because the primers only bind to the beginning and end of the diseased allele. Feature 2: Consumables Kit The open PCR machine, fluorimeter, and pipette/lab materials will all be packaged together in a small and convenient box. The PCR machine will come disassembled, but can easily be put together by following the step by step process found on the machine's website. The fluorimeter will have step by step instructions and an app for smartphones to guide one through the process. One of the major weaknesses for the consumables kit was that the SYBR green needed to be shielded from light in order to function properly. In our experiment we used tin foil to cover, but with the new packaging, the SYBR green would come in a light-proof container, thereby making experimentation easier. The micropipette would come with 2 tubes in order to be able to transfer 2 samples at the same time, making it easier and quicker to complete experimentation. Feature 3: Hardware - PCR Machine & Fluorimeter The PCR machine will come disassembled in the package. An easy to follow, step-by-step instruction manual will be included to show how to put the machine together. The fluorimeter will come with instructions as well as a link to an app that leads one through the process. The app will have the pictures ready to use with Imagej on any computer system. The PCR machine will have better interfacing options including a program built into the machine rather than connecting to a computer to see results. There will also be a timer built onto the PCR machine to keep track of each step in the reaction process. The fluorimeter will be redesigned with a phone cradle compatible for all phones to keep them in place. The phone cradle allows the pictures to be taken at a consistent distance from the slide for each measurement. It will also include an adjustable platform to change the height of your phone. The system will include a cord to plug the phone in and upload pictures directly to imageJ. The current design of the PCR machine will be altered to address the weaknesses such as waste from plastic tips, keeping track of tubes, and keeping the SYBR green covered with aluminum foil at all times. It will no longer need to be connected to a computer because a convenient program will be built onto the machine. The current design of the fluorimeter will be altered to address the weaknesses such as the unstable phone cradle, using items to prop up the phone, and a cord to upload pictures directly to imageJ. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach The answer for calculation 4 is less than 1. The answer for calculation number 3 is also less than 1, but it is smaller than the result for calculation 4. That means that the probability that a patient will develop the disease, given a positive final test conclusion is smaller than the probability that a patient will not develop the disease, given a negative final test conclusion.