BME100 s2014:W Group1 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Maria Jose Quezada Role(s): Protocols Name: Danielle Eldred Role(s): Open PCR and Machine Testing Name: John Tobey Role(s): Research and Development Name: David Kish Role(s): Open PCR and Machine Testing Name: Khalid Al-Qahtani Role(s): Research and Development LAB 6 WRITE-UP Computer-Aided Design TinkerCAD Tinkercad is a simple program to allow us to design items in three dimensions. We simply uploaded a preexisting section of the Open PCR using the tools on the left hand tool bar. At that point we uploaded two of the preexisting fan base. Positioning the fans we prepared to group them before adding fan blades to the design. Our Design PCR Fandom design Our design is simple. To increase the cooling efficiency of the Open PCR we doubled the number of fans to double the cooling potential. Our PCR machine had issues cooling and this design change would negate the flaw we observed. This allows for more rapid cycle completion and efficient usage of time within the system. Less time will be wasted on inefficient cooling allowing more DNA replication. Feature 1: Disease SNP-Specific Primers Background on the disease-associated mutation The SNP (Single Nucleotide Polymorphism) variation, rs237025, is found in Homo Sapiens on chromosome 6:149721690. This section of DNA has multiple variations, called polymorphisms. The genes associated with SNP are SUM04 and TAR2 which linked to Type I and II diabetes. SUM04 is the Small Ubiquitin-like Modifier 4. Regulation of Nf-Kappa-β-dependent transcription of ILI2B gene control the target proteins sub-cellular localization, stability or activity. An allele alternative form of a gene that ultimatly determines the phenotype. Primer design Disease SNP-specific Forward Primer: 5' ATGATGCTTTCGATGTTGTA 3' Reverse Primer: 5' TACTACGAAAGCTACAACAT 3' When the DNA double helix is separated, the primers will only bind to the specific site on the DNA that contains perfectly complementary nucleotide bases. If the sequences are not exactly complementary, they primer(s) will not bind. This will cause the DNA amplification to fail. Feature 2: Consumables Kit The consumables will be in a separate box that has the option to be included with the box containing the entire PCR kit. The consumables box will include all of the materials used in the lab. All of the similar parts will be in separate, sealed & labeled bags. The micropipettor will be in its own, smaller box to avoid breakage. In our new design we add two fans to increase the rate of cooling of the lead, the older design was slower in decreasing the temperature of the polymerise chain reaction which gave us inaccurate data measurements. The new design provide an accurate real time polymerise chain reaction and that helps in copying one strand of DNA for example we could copy the HIV DNA because it has one strand. In the design we copied the original fan and added two fans although it will consume a higher amount of electricity and have a much higher price but you will get more accurate and less chance of bias Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]