BME100 s2014:W Group1 L6: Difference between revisions
Line 57: | Line 57: | ||
'''Primer design'''<br> | '''Primer design'''<br> | ||
* Disease SNP-specific Forward Primer: 5' ATGATGCTTTCGATGTTGTA | * Disease SNP-specific Forward Primer: 5' ATGATGCTTTCGATGTTGTA 3' | ||
* Reverse Primer: 5' TACTACGAAAGCTACAACAT | * Reverse Primer: 5' TACTACGAAAGCTACAACAT 3' | ||
When the DNA double helix is separated, the primers will only bind to the specific site on the DNA that contains perfectly complementary nucleotide bases. If the sequences are not exactly complementary, they primer(s) will not bind. This will cause the DNA amplification to fail. | When the DNA double helix is separated, the primers will only bind to the specific site on the DNA that contains perfectly complementary nucleotide bases. If the sequences are not exactly complementary, they primer(s) will not bind. This will cause the DNA amplification to fail. |
Revision as of 22:43, 22 April 2014
BME 100 Spring 2014 | Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | |||||
OUR COMPANY
LAB 6 WRITE-UPComputer-Aided DesignTinkerCAD [Instructions: A short summary (up to five sentences) of the TinkerCAD tool and how you used it in lab on November 20th]
[Instructions: Show an image of your TinkerCAD design here] [Instructions: A short paragraph describing your design. Why did you choose this design? How is it different from the original OpenPCR design?]
Feature 1: Disease SNP-Specific PrimersBackground on the disease-associated mutation [Instructions: Use the answers from questions 3 - 7 to compose, in your own words, a paragraph about rs237025] The SNP (Single Nucleotide Polymorphism) variation, rs237025, is found in Homo Sapiens on chromosome 6:149721690. This section of DNA has multiple variations, called polymorphisms. The genes associated with SNP are SUM04 and TAR2 which linked to Type I and II diabetes. SUM04 is the Small Ubiquitin-like Modifier 4. Regulation of Nf-Kappa-β-dependent transcription of ILI2B gene control the target proteins sub-cellular localization, stability or activity. An allele alternative form of a gene that ultimatly determines the phenotype. Primer design
When the DNA double helix is separated, the primers will only bind to the specific site on the DNA that contains perfectly complementary nucleotide bases. If the sequences are not exactly complementary, they primer(s) will not bind. This will cause the DNA amplification to fail.
Feature 2: Consumables KitThe consumables will be in a separate box that has the option to be included with the box containing the entire PCR kit. The consumables box will include all of the materials used in the lab. All of the similar parts will be in separate, sealed & labeled bags. The micropipettor will be in its own, smaller box to avoid breakage.
Feature 3: Hardware - PCR Machine & FluorimeterThe PCR machine will come in a separate box. It will come in separate pieces and have instructions with how to assemble the PCR machine. The fluorimeter comes flat in the same box as the PCR machine. We noticed that the PCR machine had trouble cooling down, and staying at a consistent temperature. To remedy this, a second fan was added to the machine. The inclusion of two fans in the PCR machine makes cooling more efficient and helps to maintain temperature, a vital aspect of PCR.
Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]
|