BME100 s2014:W Group1 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Maria Jose Quezada Role(s): Protocols Name: Danielle Eldred Role(s): Open PCR and Machine Testing Name: John Tobey Role(s): Research and Development Name: David Kish Role(s): Open PCR and Machine Testing Name: Khalid Al-Qahtani Role(s): Research and Development [Instructions: add the name of your team's company and/or product here] LAB 6 WRITE-UP Computer-Aided Design TinkerCAD [Instructions: A short summary (up to five sentences) of the TinkerCAD tool and how you used it in lab on November 20th] Our Design [Instructions: Show an image of your TinkerCAD design here] [Instructions: A short paragraph describing your design. Why did you choose this design? How is it different from the original OpenPCR design?] Feature 1: Disease SNP-Specific Primers Background on the disease-associated mutation [Instructions: Use the answers from questions 3 - 7 to compose, in your own words, a paragraph about rs237025] The SNP (Single Nucleotide Polymorphism) variation, rs237025, is found in Homo Sapiens on chromosome 6:149721690. This section of DNA has multiple variations, called polymorphisms. The genes associated with SNP are SUM04 and TAR2 which linked to Type I and II diabetes. SUM04 is the Small Ubiquitin-like Modifier 4. Regulation of Nf-Kappa-β-dependent transcription of ILI2B gene control the target proteins sub-cellular localization, stability or activity. An allele alternative form of a gene that ultimatly determines the phenotype. Primer design Disease SNP-specific Forward Primer: 5' ATGATGCTTTCGATGTTGTA Reverse Primer: 5' TACTACGAAAGCTACAACAT When the DNA double helix is separated, the primers will only bind to the specific site on the DNA that contains perfectly complementary nucleotide bases. If the sequences are not exactly complementary, they primer(s) will not bind. This will cause the DNA amplification to fail. Feature 2: Consumables Kit [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] The consumables will be in a separate section of the box containing the entire PCR kit. [Instructions: IF your consumables packaging plan addresses any major weakness(es), explain how in an additional paragraph.] Feature 3: Hardware - PCR Machine & Fluorimeter [Instructions: Summarize how you will include the PCR machine and fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] The PCR machine will come in a separate box. It will come in separate pieces and have instructions with how to assemble the PCR machine. The fluorimeter comes flat in the same box as the PCR machine. [Instructions: IF your group has decided to redesign the PCR machine and/or Fluorimeter to address any major weakness(es), explain how in an additional paragraph.] We noticed that the PCR machine had trouble cooling down, and staying at a consistent temperature. To remedy this, a second fan was added to the machine. The inclusion of two fans in the PCR machine makes cooling more efficient and helps to maintain temperature, a vital aspect of PCR. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]