BME100 s2014:W Group14 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Our Team: Name: Jose Duran Name: Shawn Garcia Name: Christian Keefer Name: Karthik Puncha Name: Austin Tielke Our Product: The Thermal Cycling Spectrum LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is a tool that is used to create 3-D digital designs of objects and other items. In class, each member was required to register (for free) on TinkerCAD. Two members of Wednesday's Group 14 were required to take at least 7 lessons online in order to learn how to maneuver throughout the program and the various tools. For the class period, our lab group was designated to select a specific portion of the OpenPCR machine and improve it in a way that resulted in a positive outcome. Our Design [Instructions: A short paragraph describing your design. Why did you choose this design? How is it different from the original OpenPCR design?] PCR & Co. has performed modifications to the original OpenPCR machine in order to propel our medical product to the top of competitive medical device market. The new Thermal Cycling Spectrum performs at a level that no other machines can compete with. This device offers a wide spectrum of opportunity that allows users to perform experiments smoothly without any altercations nor difficulties. This device features a new PCR Tube holder that offers different sized holes for a different variety of PCR tubes. This allows several types of reactions to occur simultaneously during the several-hour thermal cycling period. Next, the new Thermal Cycling Spectrum features a new integrated internal system that blows the original OpenPCR machine out of the water. This internal system requires no need for an additional computational system that transfers the data to a separate device. The new internal system allows the Thermal Cycling Spectrum to operate within itself; thus, analyzing and computing data that is recorded throughout the cycling period. With the addition of a new internal system, a new port system has been created in order to withdraw and copy data that has been recorded within the internal drive. Two (2) new 3.0 USB ports and a mini-SD memory card slot have been included in order to provide multiple methods of transferring data from device to device. The extra USB port is available in order to provide an external power source in order to run the Thermal Cycling Spectrum. This has eliminated the problem of need for a stationary desktop computer in order to supply enough power to allow the device to function. Finally, the lid fastener has been drastically improved by including an alarm system that alerts the user when the lid has been securely fastened prior to the cycling period. One mini-LED screen will display a red screen until a green screen appears (on the other mini-LED screen), alerting the user that the lid has been properly fastened. Feature 1: Disease SNP-Specific Primers Background on the cancer-associated mutation Nucleotides are organic molecules that serve as the monomers of nucleic acid, or known as the building blocks of nucleic acids. Polymorphisms are coined terms for when two or more clearly different phenotypes exist in teh same population of a species. For example, a DNA sequence - A, T, C, or G - in the same genome differs between members of a biological species or paired chromosomes. Short genetic variations (dbSNP's) are made up of single nucleotide polymorphisms. After researching the SNP rs237025, it has been found in single nucleotide variations of the Homo sapiens (human) species. It is located on chromosome 6, and has no clinical significance; however, it has been linked to the health-related illness diabetes. The gene SUM04 stands for small ubiquitin-like modifier 4, which are attached to proteins and control the target proteins' sub-cellular localization, stability, and activity. Alleles are one of a number of forms of the same gene; they produce different effects. The disease associated allele for rs237025 is A-T-G, different from the non-disease allele containing G-T-G. Primer design Disease SNP-specific Forward Primer: AACCACGGGGATTGTCAGTG Reverse Primer: AGTTTTCTAATTGAGAATGC Primers A primer is a strand of nucleic acid that serves as a starting point for DNA synthesis, which is commonly experienced during the polymerase chain reaction. The enzymes that catalyze this process can only add a few nucleotides to an existing strand of DNA; however, it can only occur if there is a disease-specific primer. Forward primers will completely bind to disease-associated templates while reverse primers will perform the same function to their complimentary templates. When primers cannot completely bind to their respective templates, a polymerase chain reaction (PCR) cannot occur. If there are no disease-associated alleles, primers will not be able to function properly because there will be no disease-associated allele front- or back-end to bind to. Feature 2: Consumables Kit [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness(es), explain how in an additional paragraph.] Feature 3: Hardware - PCR Machine & Fluorimeter [Instructions: Summarize how you will include the PCR machine and fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine and/or Fluorimeter to address any major weakness(es), explain how in an additional paragraph.] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]