BME100 s2014:W Group14 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Our Team: Name: Jose Duran Name: Shawn Garcia Name: Christian Keefer Name: Karthik Puncha Name: Austin Tielke Our Product: The Thermal Cycling Spectrum A new medical system that incorporates a modified OpenPCR machine and a modified fluorimeter LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is a tool that is used to create 3-D digital designs of objects and other 3-D printing compatible items. In class, each member was required to register (for free) on TinkerCAD. Two members of Wednesday's Group 14 were required to take at least 7 lessons online in order to learn how to maneuver throughout the program and the various tools. For the class period, our lab group was designated to select a specific portion of the OpenPCR machine and improve it in a way that resulted in a positive manner. Our Design: OpenPCR Machine Modifications PCR & Co. has performed several modifications to the original OpenPCR machine in order to propel its medical product system to the top of the competitive medical device market. The new Thermal Cycling Spectrum system will include an improved rendition of the original OpenPCR machine (as well as an improved rendition of the fluorimeter, which will later be discussed) that performs at a level that no other machines can compete with. The Thermal Cycling Spectrum system will feature a new OpenPCR machine that offers a wide spectrum of capabilities, allowing users to perform experiments smoothly without any altercations nor difficulties. In short summary, this new PCR machine design features several adjustments that further enhance the user interface experience; thus, providing an ultimate experience that allows experiments and lab investigations to run smoothly, as well as more independently. The new OpenPCR machine aspect of the Thermal Cycling Spectrum system features a modified lid fastening system, an internal system accompanied with an external port system, and a modified docking station for a variety of PCR testing tubes. Further information will be provided for these modifications in the following paragraphs. Feature 1: Disease SNP-Specific Primers Background on the cancer-associated mutation Nucleotides are organic molecules that serve as the monomers of nucleic acid, or known as the building blocks of nucleic acids. Polymorphisms are coined terms for when two or more clearly different phenotypes exist in teh same population of a species. For example, a DNA sequence - A, T, C, or G - in the same genome differs between members of a biological species or paired chromosomes. Short genetic variations are made up of single nucleotide polymorphisms (SNP's). After researching the SNP rs237025, it has been found in single nucleotide variations of the Homo sapiens (human) species. It is located on chromosome 6, and has no clinical significance; however, it has been linked to the health-related illness diabetes. The gene SUM04 stands for small ubiquitin-like modifier 4, which are attached to proteins and control the target proteins' sub-cellular localization, stability, and activity. Alleles are one of a number of forms of the same gene; they produce different effects. The disease associated allele for rs237025 is A-T-G, different from the non-disease allele containing G-T-G. Primer design Disease SNP-specific Forward Primer: 5' AACCACGGGGATTGTCAGTG 3' Reverse Primer: 5' AGTTTTCTAATTGAGAATGC 3' Primers A primer is a strand of nucleic acid that serves as a starting point for DNA synthesis, which is commonly experienced during the polymerase chain reaction. The enzymes that catalyze this process can only add a few nucleotides to an existing strand of DNA; however, it can only occur if there is a disease-specific primer. Forward primers will completely bind to disease-associated templates while reverse primers will perform the same function to their complimentary templates. When primers cannot completely bind to their respective templates, a polymerase chain reaction (PCR) cannot occur. If there are no disease-associated alleles, primers will not be able to function properly because there will be no disease-associated allele front- or back-end to bind to. Feature 2: Consumables Kit PCR & Co. has also modified the consumables kit that arrives with each Thermal Cycling Spectrum machine. Similar to the original consumables kit, this kit will be assembled prior to experimentation. The consumables kit will include the following: PCR tubes PCR reaction mix solutions, 50 μL/tube; contains Taq DNA polymerase, MgCl2, and dNTP's DNA/Primer mix solutions, 50 μL/tube, each contains a different template DNA, and same forward & reverse primer Micro-pipette tips, each only used once (dispose afterwards) SYBR Green I Dye, quantity selected upon purchase Biohazard bag: to dispose waste into Kits may also include a 200 μL micropipettor, if the special edition consumable kit is purchased These products will continue to be plastic in order to promote its consumable aspect. Each portion of the consumables kit will be pre-packed in its own respective compartment with respective color coding, along with a color coding key that provides the correct identification of each primer and PCR mix solution; thus, no products are mixed or lost. The SYBR Green I dye will be placed in specific light-prevention PCR tubes in order to prevent any fraction of light from bleaching and harming the effectiveness of the dye. This method is similar to how beverage companies use darker (brown/black) glass bottles rather than lighter (green) glass bottles in order to prevent light from affecting the material within the bottle. The PCR tubes that require specific identification (for the Thermal Cycling Spectrum machine) will be accompanied with small, blank circular stickers. These stickers allow for easier user interface while writing ID's or abbreviations, and will be placed along the side of each respective PCR tube; if the stickers are placed on the top of the lid of the PCR tubes, each sticker's adhesion may be removed due to the heating lid of the Thermal Cycling Spectrum machine. Feature 3: Hardware - PCR Machine & Fluorimeter [Instructions: Summarize how you will include the PCR machine and fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] The Thermal Cycling Spectrum System The Thermal Cycling Spectrum complete system will include one (1) consumables kit, one (1) modified and newly updated OpenPCR machine, and one (1) modified and newly updated fluorimeter. Despite the consumables kit, assembly will be required for the OpenPCR machine and fluorimeter if the consumer does not select the pre-assemble option. If selected, this option will be performed in the PCR & Co.'s warehouse; however, an additional fee will be applied to the overall purchase. PCR Machine Modifications This device features a new PCR Tube holder that offers different sized holes for a different variety of PCR tubes. This allows several types of reactions to occur simultaneously during the several-hour thermal cycling period. Next, the new Thermal Cycling Spectrum features a new integrated internal system that blows the original OpenPCR machine out of the water. This internal system requires no need for an additional computational system that transfers the data to a separate device. The new internal system allows the Thermal Cycling Spectrum to operate within itself; thus, analyzing and computing data that is recorded throughout the cycling period. With the addition of a new internal system, a new port system has been created in order to withdraw and copy data that has been recorded within the internal drive. Two (2) new 3.0 USB ports and a mini-SD memory card slot have been included in order to provide multiple methods of transferring data from device to device. The extra USB port is available in order to provide an external power source in order to run the Thermal Cycling Spectrum. This has eliminated the problem of need for a stationary desktop computer in order to supply enough power to allow the device to function. Finally, the lid fastener has been drastically improved by including an alarm system that alerts the user when the lid has been securely fastened prior to the cycling period. One mini-LED screen will display a red screen until a green screen appears (on the other mini-LED screen), alerting the user that the lid has been properly fastened. Fluorimeter Modifications test [Instructions: IF your group has decided to redesign the PCR machine and/or Fluorimeter to address any major weakness(es), explain how in an additional paragraph.] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]