BME100 s2014:W Group14 L6: Difference between revisions
(6 intermediate revisions by the same user not shown) | |||
Line 12: | Line 12: | ||
=OUR COMPANY= | =OUR COMPANY= | ||
[[Image:PCRandCo_Logo.PNG|400px]]<br> | |||
<br> | |||
'''Our Team:'''<br><br> | |||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- valign="top" | |- valign="top" | ||
Line 21: | Line 24: | ||
|} | |} | ||
'''Our Product: The Thermal Cycling Spectrum'''<br><br> | |||
''' | |||
=LAB 6 WRITE-UP= | =LAB 6 WRITE-UP= | ||
Line 51: | Line 53: | ||
'''Primer design'''<br> | '''Primer design'''<br> | ||
* Disease SNP-specific Forward Primer: AACCACGGGGATTGTCAGTG | * Disease SNP-specific Forward Primer: 5' AACCACGGGGATTGTCAGTG 3' | ||
* Reverse Primer: AGTTTTCTAATTGAGAATGC | * Reverse Primer: 5' AGTTTTCTAATTGAGAATGC 3' | ||
Revision as of 20:52, 22 April 2014
BME 100 Spring 2014 | Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | |||||
OUR COMPANYOur Product: The Thermal Cycling Spectrum LAB 6 WRITE-UPComputer-Aided DesignTinkerCAD TinkerCAD is a tool that is used to create 3-D digital designs of objects and other items. In class, each member was required to register (for free) on TinkerCAD. Two members of Wednesday's Group 14 were required to take at least 7 lessons online in order to learn how to maneuver throughout the program and the various tools. For the class period, our lab group was designated to select a specific portion of the OpenPCR machine and improve it in a way that resulted in a positive outcome. Our Design [Instructions: A short paragraph describing your design. Why did you choose this design? How is it different from the original OpenPCR design?]
Feature 1: Disease SNP-Specific PrimersBackground on the cancer-associated mutation Nucleotides are organic molecules that serve as the monomers of nucleic acid, or known as the building blocks of nucleic acids. Polymorphisms are coined terms for when two or more clearly different phenotypes exist in teh same population of a species. For example, a DNA sequence - A, T, C, or G - in the same genome differs between members of a biological species or paired chromosomes. Short genetic variations (dbSNP's) are made up of single nucleotide polymorphisms. After researching the SNP rs237025, it has been found in single nucleotide variations of the Homo sapiens (human) species. It is located on chromosome 6, and has no clinical significance; however, it has been linked to the health-related illness diabetes. The gene SUM04 stands for small ubiquitin-like modifier 4, which are attached to proteins and control the target proteins' sub-cellular localization, stability, and activity. Alleles are one of a number of forms of the same gene; they produce different effects. The disease associated allele for rs237025 is A-T-G, different from the non-disease allele containing G-T-G. Primer design
Feature 2: Consumables Kit[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness(es), explain how in an additional paragraph.]
Feature 3: Hardware - PCR Machine & Fluorimeter[Instructions: Summarize how you will include the PCR machine and fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine and/or Fluorimeter to address any major weakness(es), explain how in an additional paragraph.]
Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]
|