BME100 s2014:W Group12 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Jacqueline Stokes Name: RJ Parkinson Name: Austin Doyle Name: Anthony Zlaket Name: Sara Jerez [Instructions: add the name of your team's company and/or product here] LAB 6 WRITE-UP TinkerCAD ==Computer-Aided Design== [Instructions: A short summary (up to five sentences) of the TinkerCAD tool and how you used it in lab on November 20th] Our Design [Instructions: Show an image of your TinkerCAD design here] [Instructions: A short paragraph describing your design. Why did you choose this design? How is it different from the original OpenPCR design?] Feature 1: Disease SNP-Specific Primers Background on the cancer-associated mutation rs237025 is a variation, or a polymorphism, in a DNA strand. It is found in homo-sapiens and the clinical significance is listed as "other." The specific chromosome this variation is located on is 6:149721690. Some example diseases associated with this are diabetes, rheumatoid arthritis, and psoriasis vulgaris. This SNP is associated with the gene sum04TAB2, which stands for Small Ubiquitin-like modifier 4. The molecular function of this gene is to attach to proteins to control localization, stability, or activity. Primer design Disease SNP-specific Forward Primer: 5' TGATTATGATGCTTTCGATG Reverse Primer: 5' AGTTTTCTAATTGAGAATGC How the primers work: Based on the way the disease-specific primer is designed, the forward primer will bind 100% to a complementary disease-SNP-containing template from a patient sample. The reverse primer will bind 100% to its complementary template. If either primer cannot bind 100% to a template, PCR cannot occur. There would be a different PCR result if the template contains the non-disease allele, seen as CACATCACTGTCATAGAGCT. Feature 2: Consumables Kit [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness(es), explain how in an additional paragraph.] Feature 3: Hardware - PCR Machine & Fluorimeter [Instructions: Summarize how you will include the PCR machine and fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine and/or Fluorimeter to address any major weakness(es), explain how in an additional paragraph.] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]