BME100 s2014:W Group11 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Christopher Stark Name: Kandace Donaldson Name: Jordan Nelson Name: Cassiana Wright Name: Yash Jain [Instructions: add the name of your team's company and/or product here] LAB 6 WRITE-UP Computer-Aided Design TinkerCAD [Instructions: A short summary (up to five sentences) of the TinkerCAD tool and how you used it in lab on November 20th] Our Design [Instructions: Show an image of your TinkerCAD design here] [Instructions: A short paragraph describing your design. Why did you choose this design? How is it different from the original OpenPCR design?] Feature 1: Disease SNP-Specific Primers Background on the cancer-associated mutation SNP stands for "single nucleotide polymorphism". A nucleotide is the molecule that makes up the coding part of DNA. Its four types, A, T, C, and G, are arranged in a meaningful sequence that determines the proteins that will code to express each gene. A polymorphism is the occurrence of different forms of a gene that exist in high frequency in a population. Therefore, SNPs occur where there is a common variation of one nucleotide in a particular gene. The rs237025 SNP exists in humans, or Homo sapiens, and is located on chromosome six. It is associated with the SUMO4 and TAB2 genes and is clinically significant as a risk factor. This is because the SNP is associated with type 1 diabetes. SUMO4 stands for "small ubiquitin-like modifier 4". The function of this gene is to modify the protein IKBA so that it represses the expression of NF-kappa-B-dependent transcription of the IL12B gene, which codes for a cytokine that acts on natural killer cells. The allele (or version of a gene) that differs between SUMO4 genes consists of three nucleotides. The non-disease allele contains the sequence GTG. The disease-associated allele consists of ATG. Primer design Disease SNP-specific Forward Primer: 5' AACCACGGGGATTGTCAATG 3' Reverse Primer: 5' AGTTTTCTAATTGAGAATGC 3' How the primers work: The forward primer is designed to complement twenty base pairs of the SNP containing the disease-associated allele. The reverse primer complements a sequence of the gene 200 base pairs away from the SNP. If both the forward and reverse primer are able to bind completely to those complementary sequences, the gene will be amplified during PCR. However, if one of the primers does not bind fully, PCR does not occur. Since the forward primer specifically contains the disease-associated allele in its sequence, it can only bind fully to DNA that also has the disease-associated allele. Thus, PCR will only occur if the DNA has the disease-associated allele, meaning this DNA will be amplified, and DNA with the non-disease allele will not. Feature 2: Consumables Kit 1. Micropipettor with holder 2. "Tube sheet" with telecoping lid 3. Pipette tips with box 4. Glass Slides 5. Reagents (PCR mix, buffer, SYBR Green I, Primers) in clearly labelled vials The micropipette will be packaged in a box with a plastic mold to sit in along with a pipette holder for use between pipetting. Rather than having individual tubes that are not reusable for multiple experiments, a sheet of closable tubes embedded and conjoined together that is able to be autoclaved will be used. This will be fitted with a plastic, telescoping lid so that during the experiment, light can be minimized from hitting the SYBR Green I as long as you are not directly under a light source. Additionally, each embedded tube in the sheet will have a default label such as A1, A2, A3, B1, B2.. etc. as well as a space to write your own label if preferred. The sheet will be able to be placed into the PCR machine if desired rather than using the default sheet that needs individual tubes. Pipette tips will be packaged in plastic boxes, however, we will significantly reduce the amount of plastic used to make the box to make it cheaper. The packaging plan addresses a few weaknesses. First, the telescoping lid will aid in protecting the SYBR Green I dye from light sources coming at an angle since this was a huge issue for many people. Also, the hope is the autoclavable tube sheet will cut down on costs in the long run because individual tubes will not be required. The reduced plastic pipette tips box also cut down costs. The micropipettor holder will help protect the pipette during periods of nonuse and make it even easier than it already is to use. And finally, the labels on the tube sheet should aid in keeping track of the tubes. Feature 3: Hardware - PCR Machine & Fluorimeter [Instructions: Summarize how you will include the PCR machine and fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine and/or Fluorimeter to address any major weakness(es), explain how in an additional paragraph.] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease.] Calculation 3 describes the probability that a person who has a positive final PCR test conclusion will develop the disease in question, type 1 diabetes.