BME100 s2014:W Group10 L6: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(New page: {|{{table}} width="800" |- |style="background-color: #EEE"|128px<span style="font-size:22px;"> BME 100 Spring 2014</span> |style="background-color: #F2F2F2" ...)
 
 
(10 intermediate revisions by 2 users not shown)
Line 14: Line 14:
{| style="wikitable" width="700px"
{| style="wikitable" width="700px"
|- valign="top"
|- valign="top"
| [[Image:BME103student.jpg|100px|thumb|Name: student]]
| [[Image:644699_10151554563887350_1724285834_n.jpg|100px|thumb|Name: Ashley Woodward<br>Role(s)]]
| [[Image:BME103student.jpg|100px|thumb|Name: student]]
| [[Image:Sdsdfmkhnjf;hjsdlfhs.jpg|100px|thumb|Name: Diljot Nagra<br>Role(s)]]
| [[Image:BME103student.jpg|100px|thumb|Name: student]]
| [[Image:562456_3960628223871_1973147888_n.jpg|100px|thumb|Name: Matthew Devera<br>Role(s)]]
| [[Image:BME103student.jpg|100px|thumb|Name: student]]
| [[Image:IMG 139744943951373.jpeg|100px|thumb|Name: Fields Soumis Hyrkas<br>Role(s)]]
| [[Image:BME103student.jpg|100px|thumb|Name: student]]
| [[Image:20130908 152230.jpg|100px|thumb|Name: Akihiko Ishihara<br>Role(s)]]
| [[Image:BME103student.jpg|100px|thumb|Name: student]]
|}
|}


Line 34: Line 33:
'''TinkerCAD'''<br>
'''TinkerCAD'''<br>


''[Instructions: A short summary (up to five sentences) of the TinkerCAD tool and how you used it in lab on November 20th]''<br>
Tinkercad is used to create 3D objects and designs. This program is easier than a lot of other design software because it is for beginner designers. The main group of people who use Tinkercad are children. In this program we created an Open PCR machine that is an improvement on the PCR machine that we have now. We created a design that holds many more spots for DNA so that the replication process is faster.<br>




'''Our Design'''<br>
'''Our Design'''<br>


''[Instructions: Show an image of your TinkerCAD design here]''
[[Image:BME 100 tinkercad.jpg|600px|]]<br>


''[Instructions: A short paragraph describing your design. Why did you choose this design? How is it different from the original OpenPCR design?]''<br>
This design has spaces for more tubes than the OPEN PCR design that is out now. This PCR machine is larger, stronger, and more sturdy than the Open PCR machine now. This machine can heat up and cool down faster because there is a larger heating and cooling system. Therefore, the machine goes through the cycles faster than the PCR machine that we have now. This machine is also more efficient and speeds up the entire process of DNA replication because there is room for more samples and the machine is faster.




Line 48: Line 47:


==Feature 1: Disease SNP-Specific Primers==
==Feature 1: Disease SNP-Specific Primers==
''[Instructions: This information will come from the exercises you did in PCR Lab B.]''


'''Background on the cancer-associated mutation'''<br>
'''Background on the cancer-associated mutation'''<br>


''[Instructions: Use the answers from questions 3 - 7 to compose, in your own words, a paragraph about rs237025]''
For detecting cancer associated sequences, some background information must be known. A nucleotide is a five-carbon sugar with one phosphate group. Nucleotides make up the basic units of DNA and RNA molecules. A polymorphism is a DNA sequence variation that is common in the population. rs237025 is a variation found in homosapiens. The chromosome variance is located on 6:149721690 and the clinical significance of this SNP is other. This SNP is associated with SUMO4 and TAB2. We found that rs17879961 has an affected gene called CHEK2. This cancer related function of CHEK2 is used in response to DNA damage and replication. Once this is activated entry to mitosis is prevented and mutations to this gene are a condition that's already been set to sarcomas, breast cancer, and brain tumors.  SUMO4 stands for small ubiquitin-related modifier 4. The molecular function of this gene is to encode small ubiquitin-related modifiers that are attached to proteins and control the target proteins' subcellular localization, stability. The protein described in this record is located in the cytoplasm and specifically modifies IKBA. The non-disease allele contains GTG.A. Change in this allele at the G position is linked to the disease. The allele is ATG. The diseased associated with the allele is type 1 diabetes.
 
 


'''Primer design'''<br>
'''Primer design'''<br>


* Disease SNP-specific Forward Primer: ''[Instructions: type the sequence of the forward primer]''
* Disease SNP-specific Forward Primer:5' TACTTCGTCTAGTCTAAGGC
* Reverse Primer: ''[Instructions: type the sequence of the reverse primer]''
* Reverse Primer: 5' AGTTTTCTAATTGAGAATCG


How the primers work: ''[Instructions: explain what makes the primers disease-sequence specific. In other words, explain why the primers will amplify DNA that contains the cancer-associated SNP, and will not exponentially amplify DNA that has the non-disease allele.]''
How the primers work: DNA primer's are strands of nucleotides that are complementary to specific regions on DNA strands. DNA strands usually bind to other strands which are complementary to one another. Therefore, these primers will attach onto DNA strands which will match. Knowing this we can use specific primers to attach onto specific DNA strands that people are trying to amplify. It creates a specific primer that can be geared towards a specific sequence of DNA and it will amplify and attach to those strands. This process is then repeated through the heating and cooling process done in the PCR machine, to make many strands of DNA.




Line 68: Line 63:
<!-- Note: Be sure to delete the instruction text in brackets: ''[ ]'' -->
<!-- Note: Be sure to delete the instruction text in brackets: ''[ ]'' -->


==Feature 2: Consumables Kit==
==Feature 2: Consumables Kit==<br>


''[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.]''
Our consumable kit we would include a PCR tube plate, micropipettor, pipette tips, PCR tubes and holder, and PCR tube refills. Our pipette tips would be packaged so that the tips stacked one on top of the other to conserve space and allow for easy loading. The tube plate would resemble a tray that gives easier transportation and better handling. The individual PCR tubes would prepared in a small plastic box for ease of stabilty. We would also include a box of PCR tubes refills.The consumables will be packaged in a normal manner. Our kits will takes up the least space while still allowing each of them to be fully surrounded in Styrofoam for protection. The PCR tubes, micropipettor, and micropipettor tips will all be together in one box fully surrounded in Styrofoam for protection (primarily for the micropipettor). The primers and PCR mix will be packaged separately so that they can be cooled until the time of experimentation. All but the micropipettor are made of plastic, and therefore not significantly fragile, so no extensive protection is necessary beyond styrofoam in the box with the micropipettor
 
''[Instructions: IF your consumables packaging plan addresses any major weakness(es), explain how in an additional paragraph.]''
 
 
<!-- Note: Be sure to delete the text in brackets: ''[ ]'' -->


==Feature 3: Hardware - PCR Machine & Fluorimeter==
==Feature 3: Hardware - PCR Machine & Fluorimeter==


''[Instructions: Summarize how you will include the PCR machine and fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.]''
''[Instructions: IF your group has decided to redesign the PCR machine and/or Fluorimeter to address any major weakness(es), explain how in an additional paragraph.]''


How we would include the PCR machine and the fluorimeter into one system is by putting a cameras and the blue fluorescent inside the PCR machine itself. So that when the cycles are done for each tube and after it cools down the machine will automatically add  sybr green to each tube. Afterwards the blue fluorescent light will shine each tube and the 5 megapixels camera ,removed from a smartphone, will take a picture and it will store the image and send it to imageJ.


<!-- Note: Be sure to delete the text in brackets: ''[ ]'' -->
We would change the PCR machine is to decrease the amount of time to complete the cycles. Also we would add more slots for the PCR tubes to go into so more experiments would be completed. Adding on to that we would make the PCR tubes more transparent for the lgiht ti shine though it.In addition the material that the PCR machine was quite fragile and the screws that were holding it together was quite tedious to remove. We would change the material that it made of into a durable heat resist plastic to keep the weight a price reasonable. For the screws there would be no need for washers falling into the machine it would be us notches to hold the sides together and 8 screws into total.Each screw going into the top and bottom corners of the machine. For the fluorimeter by adding the whole hardware into the PCR machine we remove the human error.Also there would be a adjustable slider for the camera to move instance of using trays to level the camera to the liquid. Another perk by putting the whole system into one machine we remove the need of having a box to provide darkness because the door that goes over the PCR tubes which would already provide a sufficient amount of darkness for the system.


==Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach==
==Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach==

Latest revision as of 10:02, 23 April 2014

BME 100 Spring 2014 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR COMPANY

Name: Ashley Woodward
Role(s)
Name: Diljot Nagra
Role(s)
Name: Matthew Devera
Role(s)
Name: Fields Soumis Hyrkas
Role(s)
Name: Akihiko Ishihara
Role(s)


[Instructions: add the name of your team's company and/or product here]


LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD

Tinkercad is used to create 3D objects and designs. This program is easier than a lot of other design software because it is for beginner designers. The main group of people who use Tinkercad are children. In this program we created an Open PCR machine that is an improvement on the PCR machine that we have now. We created a design that holds many more spots for DNA so that the replication process is faster.


Our Design


This design has spaces for more tubes than the OPEN PCR design that is out now. This PCR machine is larger, stronger, and more sturdy than the Open PCR machine now. This machine can heat up and cool down faster because there is a larger heating and cooling system. Therefore, the machine goes through the cycles faster than the PCR machine that we have now. This machine is also more efficient and speeds up the entire process of DNA replication because there is room for more samples and the machine is faster.



Feature 1: Disease SNP-Specific Primers

Background on the cancer-associated mutation

For detecting cancer associated sequences, some background information must be known. A nucleotide is a five-carbon sugar with one phosphate group. Nucleotides make up the basic units of DNA and RNA molecules. A polymorphism is a DNA sequence variation that is common in the population. rs237025 is a variation found in homosapiens. The chromosome variance is located on 6:149721690 and the clinical significance of this SNP is other. This SNP is associated with SUMO4 and TAB2. We found that rs17879961 has an affected gene called CHEK2. This cancer related function of CHEK2 is used in response to DNA damage and replication. Once this is activated entry to mitosis is prevented and mutations to this gene are a condition that's already been set to sarcomas, breast cancer, and brain tumors. SUMO4 stands for small ubiquitin-related modifier 4. The molecular function of this gene is to encode small ubiquitin-related modifiers that are attached to proteins and control the target proteins' subcellular localization, stability. The protein described in this record is located in the cytoplasm and specifically modifies IKBA. The non-disease allele contains GTG.A. Change in this allele at the G position is linked to the disease. The allele is ATG. The diseased associated with the allele is type 1 diabetes.

Primer design

  • Disease SNP-specific Forward Primer:5' TACTTCGTCTAGTCTAAGGC
  • Reverse Primer: 5' AGTTTTCTAATTGAGAATCG

How the primers work: DNA primer's are strands of nucleotides that are complementary to specific regions on DNA strands. DNA strands usually bind to other strands which are complementary to one another. Therefore, these primers will attach onto DNA strands which will match. Knowing this we can use specific primers to attach onto specific DNA strands that people are trying to amplify. It creates a specific primer that can be geared towards a specific sequence of DNA and it will amplify and attach to those strands. This process is then repeated through the heating and cooling process done in the PCR machine, to make many strands of DNA.



==Feature 2: Consumables Kit==

Our consumable kit we would include a PCR tube plate, micropipettor, pipette tips, PCR tubes and holder, and PCR tube refills. Our pipette tips would be packaged so that the tips stacked one on top of the other to conserve space and allow for easy loading. The tube plate would resemble a tray that gives easier transportation and better handling. The individual PCR tubes would prepared in a small plastic box for ease of stabilty. We would also include a box of PCR tubes refills.The consumables will be packaged in a normal manner. Our kits will takes up the least space while still allowing each of them to be fully surrounded in Styrofoam for protection. The PCR tubes, micropipettor, and micropipettor tips will all be together in one box fully surrounded in Styrofoam for protection (primarily for the micropipettor). The primers and PCR mix will be packaged separately so that they can be cooled until the time of experimentation. All but the micropipettor are made of plastic, and therefore not significantly fragile, so no extensive protection is necessary beyond styrofoam in the box with the micropipettor

Feature 3: Hardware - PCR Machine & Fluorimeter

How we would include the PCR machine and the fluorimeter into one system is by putting a cameras and the blue fluorescent inside the PCR machine itself. So that when the cycles are done for each tube and after it cools down the machine will automatically add sybr green to each tube. Afterwards the blue fluorescent light will shine each tube and the 5 megapixels camera ,removed from a smartphone, will take a picture and it will store the image and send it to imageJ.

We would change the PCR machine is to decrease the amount of time to complete the cycles. Also we would add more slots for the PCR tubes to go into so more experiments would be completed. Adding on to that we would make the PCR tubes more transparent for the lgiht ti shine though it.In addition the material that the PCR machine was quite fragile and the screws that were holding it together was quite tedious to remove. We would change the material that it made of into a durable heat resist plastic to keep the weight a price reasonable. For the screws there would be no need for washers falling into the machine it would be us notches to hold the sides together and 8 screws into total.Each screw going into the top and bottom corners of the machine. For the fluorimeter by adding the whole hardware into the PCR machine we remove the human error.Also there would be a adjustable slider for the camera to move instance of using trays to level the camera to the liquid. Another perk by putting the whole system into one machine we remove the need of having a box to provide darkness because the door that goes over the PCR tubes which would already provide a sufficient amount of darkness for the system.

Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]