BME100 s2014:T Group9 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Cassaundra Kinnear Name: Katherine Underwood Name: Kyle Queen Name: Mohammed Binsheliail LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is a straightforward and easy to use program that allows the user to create different visual projects. The user can select from premade shapes the program offers, like spheres or cubes, and warp them in different sizes. It is also possible to change the color and combined many shapes into the desired pictures. TinkerCAD was used in this lab to effectively show the design being presented by this group. [ADD IMAGE HERE] Our Design The idea behind the design was to allow a different style of teaching to occur. Because the previous PCR machines were made of opaque materials, students did not have an inside look of what was going on. With this design, students and professors can view the process while it is happening and have an overall more complete understanding of the PCR machines. Feature 1: Disease SNP-Specific Primers Background on the disease-associated mutation It was found the species for this variation is homo sapien. This variation is found on teh chromosome 6:149721690 and the clinical significance was listed as other. This SNP is associated with the genes SUMO4 and TAB2. SUMO4, small ubiquitin-like modifier 4, is located in the cytoplasm of cells and specifically modifies IRBA. The diseases linked to it are type 1 Diabetes, Type 2 Diabetes, nephropathy, and VKH syndrome. Primer design Disease SNP-specific Forward Primer: CACCACTTAGTAAACTAATG Reverse Primer: CGTAAGAGTTAATCTTTTGA How the primers work: After separating the DNA from the double helix design into single strands, the primer binds with the DNA if and only if the primer and the existing DNA are complementary. They will continue to replicate at this point. If the template contains the non-disease allele PCR should not occur. This is due to the disease-specific primer and template not binding 1oo% to the non-disease allele because the non-disease allele had a sequence of GTG, when the disease-assocoated allele has a sequence of ATG. Feature 2: Consumables Kit The consumables kit will be held within a small b ox. This will include all the materials needed to preform a small number of PCR reactions. All items will be packaged in groups based on the item. They will then be labeled with a short description, and then they will be placed in the consumables box. This includes 1. Variety of Tubes, including the PCR tubes 2. SYBR Green I sample 3. Micro Pipette Tips 4. Primer sample 5. Micro-pipette 6. Tray to hold tubes Feature 3: Hardware - PCR Machine & Fluorimeter In order to create an easier teaching environment, the current PCR design has been revamped to include a clear lid. The lid will consist of both glass and plastic. The glass will be facing the samples on the inside of the lid in order to keep the samples safe from outside contaminants and regulate the temperature, and heavy duty plastic will surround the glass to give more stability to the machine. Both the PCR machine and Fluorimeter will be packaged in separate boxes for clarity and then placed in a larger box, along with the consumables kit. They will both come dismantled but this will include an easy to follow, picture instructions to help users easily mantle the PCR machine and Fluorimeter. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach When looking into the PCR results, it was made clear that the machine did not do the best job at predicting illness. For the percentage of people who developed the disease and also received a positive result from the machine was not a strong percentage. Unfortunately, it was not close to one, like it ideally would be. On the other hand, the people who did not develop the illness and received a negative result was closer to 1 than the prior results. While that is a much stronger result, overall the machine does not have a strong reliability.