BME100 s2014:T Group9 L6: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
 
(18 intermediate revisions by 2 users not shown)
Line 21: Line 21:




''[Instructions: add the name of your team's company and/or product here]''
[[Image:Bmeallele.png‎]]




Line 32: Line 32:
'''TinkerCAD'''<br>
'''TinkerCAD'''<br>


''[Instructions: A short summary (up to five sentences) of the TinkerCAD tool and how you used it in lab on November 20th]''<br>
TinkerCAD is a straightforward and easy to use program that allows the user to create different visual projects. The user can select from premade shapes the program offers, like spheres or cubes, and warp them in different sizes. It is also possible to change the color and combined many shapes into the desired pictures.




'''Our Design'''<br>


''[Instructions: Show an image of your TinkerCAD design here]''
'''Our Design'''
 
<br> Our design will be a software change versus a physical change to the PCR machine. The current design of the machine is solid.  It is comprised of affordable materials that are durable and reliable.  However, the software is extremely simple and seems to lack something.  Our idea is to add an animation to show what is actually happening within the machine.  It is not going to be a microscopic view of the actually reaction, but it will be a pre-made video that will show the steps of PCR as it goes through each cycle.  This will allow teachers to help students learn what is actually happening within the machine.  It will also help students understand how much DNA is actually being replicated per cycle.
''[Instructions: A short paragraph describing your design. Why did you choose this design? How is it different from the original OpenPCR design?]''<br>




Line 46: Line 44:


==Feature 1: Disease SNP-Specific Primers==
==Feature 1: Disease SNP-Specific Primers==
''[Instructions: This information will come from the exercises you did in PCR Lab B.]''


'''Background on the disease-associated mutation'''<br>
'''Background on the disease-associated mutation'''<br>


''[Instructions: Use the answers from questions 3 - 7 to compose, in your own words, a paragraph about rs237025]''
It was found the species for this variation is homo sapien. This variation is found on teh chromosome 6:149721690 and the clinical significance was listed as other. This SNP is associated with the genes SUMO4 and TAB2. SUMO4, small ubiquitin-like modifier 4, is located in the cytoplasm of cells and specifically modifies IRBA. The diseases linked to it are type 1 Diabetes, Type 2 Diabetes, nephropathy, and VKH syndrome.




Line 57: Line 53:
'''Primer design'''<br>
'''Primer design'''<br>


* Disease SNP-specific Forward Primer: ''[Instructions: type the sequence of the forward primer]''
* Disease SNP-specific Forward Primer: CACCACTTAGTAAACTAATG
* Reverse Primer: ''[Instructions: type the sequence of the reverse primer]''
* Reverse Primer: CGTAAGAGTTAATCTTTTGA
 
<br>How the primers work: After separating the DNA from the double helix design into single strands, the primer binds with the DNA if and only if the primer and the existing DNA are complementary. They will continue to replicate at this point.


How the primers work: ''[Instructions: explain what makes the primers disease-sequence specific. In other words, explain why the primers will amplify DNA that contains the disease-associated SNP, and will not exponentially amplify DNA that has the non-disease allele.]''
If the template contains the non-disease allele PCR should not occur. This is due to the disease-specific primer and template not binding 1oo% to the non-disease allele because the non-disease allele had a sequence of GTG, when the disease-assocoated allele has a sequence of ATG.




Line 82: Line 80:
==Feature 3: Hardware - PCR Machine & Fluorimeter==
==Feature 3: Hardware - PCR Machine & Fluorimeter==


''[Instructions: Summarize how you will include the PCR machine and fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.]''
The new design for the software will allow for easier teaching and better understanding of why the PCR machine is being used. It gives a visual to all of the confusing words and terms being thrown around when describing the PCR process. The video will contain narration and labels for each component of the replication process.
 
''[Instructions: IF your group has decided to redesign the PCR machine and/or Fluorimeter to address any major weakness(es), explain how in an additional paragraph.]''


<br>Both the PCR machine and Fluorimeter will be packaged in separate boxes for clarity and then placed in a larger box, along with the consumables kit. They will both come dismantled but this will include an easy to follow, picture instructions to help users easily mantle the PCR machine and Fluorimeter.


<!-- Note: Be sure to delete the text in brackets: ''[ ]'' -->
<!-- Note: Be sure to delete the text in brackets: ''[ ]'' -->


==Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach==
==Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach==
''[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "close to one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]''
When looking into the PCR results, it was made clear that the machine did not do the best job at predicting illness. For the percentage of people who developed the disease and also received a positive result from the machine was not a strong percentage. Unfortunately, it was not close to one, like it ideally would be. On the other hand, the people who did not develop the illness and received a negative result was closer to 1 than the prior results. While that is a much stronger result, overall the machine does not have a strong reliability.  
When looking into the PCR results, it was made clear that the machine did not do the best job at predicting illness. For the percentage of people who developed the disease and also received a positive result from the machine was not a strong percentage. Unfortunately, it was not close to one, like it ideally would be. On the other hand, the people who did not develop the illness and received a negative result was closer to 1 than the prior results. While that is a much stronger result, overall the machine does not have a strong reliability.  
   
   
<!-- Do not edit below this line -->
<!-- Do not edit below this line -->
|}
|}

Latest revision as of 10:26, 24 April 2014

BME 100 Spring 2014 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR COMPANY

Name: Cassaundra Kinnear
Name: Katherine Underwood
Name: Kyle Queen
Name: Mohammed Binsheliail



LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD

TinkerCAD is a straightforward and easy to use program that allows the user to create different visual projects. The user can select from premade shapes the program offers, like spheres or cubes, and warp them in different sizes. It is also possible to change the color and combined many shapes into the desired pictures.


Our Design
Our design will be a software change versus a physical change to the PCR machine. The current design of the machine is solid. It is comprised of affordable materials that are durable and reliable. However, the software is extremely simple and seems to lack something. Our idea is to add an animation to show what is actually happening within the machine. It is not going to be a microscopic view of the actually reaction, but it will be a pre-made video that will show the steps of PCR as it goes through each cycle. This will allow teachers to help students learn what is actually happening within the machine. It will also help students understand how much DNA is actually being replicated per cycle.



Feature 1: Disease SNP-Specific Primers

Background on the disease-associated mutation

It was found the species for this variation is homo sapien. This variation is found on teh chromosome 6:149721690 and the clinical significance was listed as other. This SNP is associated with the genes SUMO4 and TAB2. SUMO4, small ubiquitin-like modifier 4, is located in the cytoplasm of cells and specifically modifies IRBA. The diseases linked to it are type 1 Diabetes, Type 2 Diabetes, nephropathy, and VKH syndrome.


Primer design

  • Disease SNP-specific Forward Primer: CACCACTTAGTAAACTAATG
  • Reverse Primer: CGTAAGAGTTAATCTTTTGA


How the primers work: After separating the DNA from the double helix design into single strands, the primer binds with the DNA if and only if the primer and the existing DNA are complementary. They will continue to replicate at this point.

If the template contains the non-disease allele PCR should not occur. This is due to the disease-specific primer and template not binding 1oo% to the non-disease allele because the non-disease allele had a sequence of GTG, when the disease-assocoated allele has a sequence of ATG.



Feature 2: Consumables Kit

The consumables kit will be held within a small b ox. This will include all the materials needed to preform a small number of PCR reactions. All items will be packaged in groups based on the item. They will then be labeled with a short description, and then they will be placed in the consumables box.

This includes
1. Variety of Tubes, including the PCR tubes
2. SYBR Green I sample
3. Micro Pipette Tips
4. Primer sample
5. Micro-pipette
6. Tray to hold tubes


Feature 3: Hardware - PCR Machine & Fluorimeter

The new design for the software will allow for easier teaching and better understanding of why the PCR machine is being used. It gives a visual to all of the confusing words and terms being thrown around when describing the PCR process. The video will contain narration and labels for each component of the replication process.


Both the PCR machine and Fluorimeter will be packaged in separate boxes for clarity and then placed in a larger box, along with the consumables kit. They will both come dismantled but this will include an easy to follow, picture instructions to help users easily mantle the PCR machine and Fluorimeter.


Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

When looking into the PCR results, it was made clear that the machine did not do the best job at predicting illness. For the percentage of people who developed the disease and also received a positive result from the machine was not a strong percentage. Unfortunately, it was not close to one, like it ideally would be. On the other hand, the people who did not develop the illness and received a negative result was closer to 1 than the prior results. While that is a much stronger result, overall the machine does not have a strong reliability.