BME100 s2014:T Group8 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Nicole Plachecki Name: Colton Tucker Name: Calloway Freeland Name: Hooyoung Kim Name: Omar Benitez [Instructions: add the name of your team's company and/or product here] LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TickerCAD is a computer system that can design three dimensional design images. The program is very straightforward and user friendly. Lessons teach the basics of the program and then you have the ability to create your own images. You can even import generate shapes and designs. Our Design Our new design incorporates a computer into the PCR machine so that all data could be retrieved straight from the device wihtout having to use an external computer. Our group noticed some aspects of Open PCR that could be improved. They were: 1. A computer is required to utilize the PCR machine. 2. It takes very long to do PCR, therefore the more dna slots, the more efficient testing is. 3. The dna wells are unlabeled, and could cause mix-ups. What we did to change this was to attach a mini computer to the PCR. Therefore no external computer will be needed. This computer is attached to the heater and cooler, and has a tray with dna wells that can be pulled out. The difference here is that the wells are more in number, and are labeled as well in order to prevent mistakes. Feature 1: Disease SNP-Specific Primers [Instructions: This information will come from the exercises you did in PCR Lab B.] Background on the disease-associated mutation rs237025 is a single nucleotide polymorphism (SNP). Nucleotides are a building block for DNA, they are one of the "letters" that construct codons. Polymorphisms are a common variation in DNA sequence between individual people. The SNP rs237025 is found in homo sapiens and located on chromosome 6. It is associated with the the gene SUMO4 as well as TAB2. SUMO4 stands for small ubiquitin-like modifier 4, and is responsible for controlling target proteins' subcellular localization, stability or activity. Several diseases are linked to the SNP rs237025 such as Type 1 and 2 Diabetes, nephropathy, rheumatoid arthritis, and psoriasis vulgaris. The non-disease allele contains GTG, however a change in this allele at the "G" position is linked to the disease. The disease associated allele contains the sequence ATG. Primer design Disease SNP-specific Forward Primer: 5' AACCTGCACAGTTGGAAATG Reverse Primer: 5' AGAATAGAGAAAACTATACTG How the primers work: [Instructions: explain what makes the primers disease-sequence specific. In other words, explain why the primers will amplify DNA that contains the disease-associated SNP, and will not exponentially amplify DNA that has the non-disease allele.] Every PCR reaction needs two primers, one forward and one reverse. The forward primer is disease-allele-specific because it ends with the nucleotide from the disease-associated allele. The forward primer for SNP rs237025 ends with ATG, the sequence for the disease associated allele. What this means is that the forward primer will amplify DNA that contains this disease-associated SNP, and will not react to amplify DNA without the allele. Feature 2: Consumables Kit [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness(es), explain how in an additional paragraph.] Feature 3: Hardware - PCR Machine & Fluorimeter [Instructions: Summarize how you will include the PCR machine and fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine and/or Fluorimeter to address any major weakness(es), explain how in an additional paragraph.] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "close to one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]