BME100 s2014:T Group8 L6: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 38: Line 38:
'''Our Design'''<br>
'''Our Design'''<br>


''[[Image:Newopenpcr.PNG 700px]]''
''[[Image:Newopenpcr.PNG|700px]]''


''[Instructions: A short paragraph describing your design. Why did you choose this design? How is it different from the original OpenPCR design?]''<br>
''[Instructions: A short paragraph describing your design. Why did you choose this design? How is it different from the original OpenPCR design?]''<br>

Revision as of 11:17, 17 April 2014

BME 100 Spring 2014 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR COMPANY

Name: Nicole Plachecki
Name: Colton Tucker
Name: Calloway Freeland
Name: Hooyoung Kim
Name: Omar Benitez


[Instructions: add the name of your team's company and/or product here]


LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD

TinkerCAD is a online free to use 3D modeling program. Not as advanced as industry standard CAD programs, but one of the easiest to use.


Our Design

[Instructions: A short paragraph describing your design. Why did you choose this design? How is it different from the original OpenPCR design?]



Feature 1: Disease SNP-Specific Primers

[Instructions: This information will come from the exercises you did in PCR Lab B.]

Background on the disease-associated mutation

[Instructions: Use the answers from questions 3 - 7 to compose, in your own words, a paragraph about rs237025]


rs237025 is a single nucleotide polymorphism (SNP). Nucleotides are a building block for DNA, they are one of the "letters" that construct codons. Polymorphisms are a common variation in DNA sequence between individual people. The SNP rs237025 is found in homo sapiens and located on chromosome 6. It is associated with the the gene SUMO4 as well as TAB2. SUMO4 stands for small ubiquitin-like modifier 4, and is responsible for controlling target proteins' subcellular localization, stability or activity. Several diseases are linked to the SNP rs237025 such as Type 1 and 2 Diabetes, nephropathy, rheumatoid arthritis, and psoriasis vulgaris.


Primer design

  • Disease SNP-specific Forward Primer: 5' AACCTGCACAGTTGGAAATG
  • Reverse Primer: 5' AGAATAGAGAAAACTATACTG

How the primers work: [Instructions: explain what makes the primers disease-sequence specific. In other words, explain why the primers will amplify DNA that contains the disease-associated SNP, and will not exponentially amplify DNA that has the non-disease allele.]



Feature 2: Consumables Kit

[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.]

[Instructions: IF your consumables packaging plan addresses any major weakness(es), explain how in an additional paragraph.]


Feature 3: Hardware - PCR Machine & Fluorimeter

[Instructions: Summarize how you will include the PCR machine and fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.]

[Instructions: IF your group has decided to redesign the PCR machine and/or Fluorimeter to address any major weakness(es), explain how in an additional paragraph.]


Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "close to one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]