BME100 s2014:T Group8 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Nicole Plachecki Name: Colton Tucker Name: Calloway Freeland Name: Hooyoung Kim Name: Omar Benitez Plachecki PCR Logo Plachecki PCR: "From Primers to Perfection" LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TickerCAD is a computer system that can design three dimensional design images. The program is very straightforward and user friendly. Lessons teach the basics of the program and then you have the ability to create your own images. You can even import generate shapes and designs. Our Design Our new design incorporates a computer into the PCR machine so that all data could be retrieved straight from the device wihtout having to use an external computer. Our group noticed some aspects of Open PCR that could be improved. They were: 1) A computer is required to utilize the PCR machine. 2) It takes very long to do PCR, therefore the more dna slots, the more efficient testing is. 3) The dna wells are unlabeled, and could cause mix-ups. What we did to change this was to attach a mini computer to the PCR. Therefore no external computer will be needed. This computer is attached to the heater and cooler, and has a tray with dna wells that can be pulled out. The difference here is that the wells are more in number, and are labeled as well in order to prevent mistakes. Feature 1: Disease SNP-Specific Primers Background on the disease-associated mutation rs237025 is a single nucleotide polymorphism (SNP). Nucleotides are a building block for DNA, they are one of the "letters" that construct codons. Polymorphisms are a common variation in DNA sequence between individual people. The SNP rs237025 is found in homo sapiens and located on chromosome 6. It is associated with the the gene SUMO4 as well as TAB2. SUMO4 stands for small ubiquitin-like modifier 4, and is responsible for controlling target proteins' subcellular localization, stability or activity. Several diseases are linked to the SNP rs237025 such as Type 1 and 2 Diabetes, nephropathy, rheumatoid arthritis, and psoriasis vulgaris. The non-disease allele contains GTG, however a change in this allele at the "G" position is linked to the disease. The disease associated allele contains the sequence ATG. Primer design Disease SNP-specific Forward Primer: 5' AACCTGCACAGTTGGAAATG Reverse Primer: 5' AGAATAGAGAAAACTATACTG How the primers work: Every PCR reaction needs two primers, one forward and one reverse. The forward primer is disease-allele-specific because it ends with the nucleotide from the disease-associated allele. The forward primer for SNP rs237025 ends with ATG, the sequence for the disease associated allele. What this means is that the forward primer will amplify DNA that contains this disease-associated SNP, and will not react to amplify DNA without the allele. Feature 2: Consumables Kit The consumables kit for our PCR Machine and Fluorimeter Set will include: One Micropipette (max 250 μL) 2 standard 8x12 containers of 200 μL micropipette tips SYBR Green 1 Dye for Fluorimetry, enough for 200 uses of 50 μL each SYBR Green comes with light-blocking tubes for use during experiments 80 PCR Tubes a plastic stand is included to hold PCR tubes A box of 40 Fluorimetry slides The light-blocking tubes for the SYBR Green address the issue of variance in the experiment due to prolonged light exposure during the experimental process. These tubes are not clear like PCR tubes and have a lockable rotational top to more easily get the substance out without over-exposing its photsensitivity. Feature 3: Hardware - PCR Machine & Fluorimeter The PCR machine and Fluorimeter will function the same in our new design. However, the new system will generate a more efficient process as well as make the machine easier to operate. The new design contains labeled DNA wells to avoid confusion and they are spaced slightly further apart so as to allow easier transfer using the Fluorimeter. Since the process takes a significant amount of time to complete, additional DNA wells have been added to create more efficient tests. The primary change made to redesign the PCR machine was the addition of a miniature computer on the machine itself. In the original design the PCR machine had to be plugged in to an external computer for testing, so we implemented a mini-computer to make the device more portable and reduce the chance of errors or mistakes involving an external device. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach Calculation 3 was not very close to one. Since this is the test that estimates the probability that a patient will develop the disease when they give a positive test, this is not very reliable. Calculation 4 was a bit closer than calculation 3 to 1, but still not "very close". This calculation was for the probability that a patient will not develop the disease when they give a negative test and is slightly reliable but not the most favorable probability.