BME100 s2014:T Group5 L6: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 53: Line 53:




''The nucleotide is commonly known as the monomer of DNA. Nucleotide is a compound consisting of a nitrogenous base, phosphate group and a sugar. Polymorphism is the occurrence of two distinct phenotypes found in a population, upon which natural selection occurs. An allele is one of numerous forms of a gene. An allele is also located at a specific position on a specific chromosome.  The SNP rs23702, is an allele found in humans (homo sapiens). The exact location of it is 149721690. It is associated with the SUM04 And TAB2 genes. The SUM04 is also called the small ubiquitin like modifier 4 gene and functions as a  missence and config reference. The SNP is also associated with Type 1 and Type 2 diabetes. The disease containing allele is ATG.''<br>
The nucleotide is commonly known as the monomer of DNA. Nucleotide is a compound consisting of a nitrogenous base, phosphate group and a sugar. Polymorphism is the occurrence of two distinct phenotypes found in a population, upon which natural selection occurs. An allele is one of numerous forms of a gene. An allele is also located at a specific position on a specific chromosome.  The SNP rs23702, is an allele found in humans (homo sapiens). The exact location of it is 149721690. It is associated with the SUM04 And TAB2 genes. The SUM04 is also called the small ubiquitin like modifier 4 gene and functions as a  missence and config reference. The SNP is also associated with Type 1 and Type 2 diabetes. The disease containing allele is ATG.<br>


'''Primer design'''<br>
'''Primer design'''<br>
Line 60: Line 60:
* Reverse Primer: ''TTGGTGCCCCTAACAGTCAC''
* Reverse Primer: ''TTGGTGCCCCTAACAGTCAC''


How the primers work: ''After the DNA is denatured and the temperature is lowered, the disease specific forward primer will bind to the complementary disease containing template at the 3' end. The reverse primer will bind to the complementary strand at the 3' end. The primers will then be used to replicate the specific section of the DNA strands. If the SNP containing template is not present the reaction will not occur as the primer will not be able to bind to the template completely.''
How the primers work: After the DNA is denatured and the temperature is lowered, the disease specific forward primer will bind to the complementary disease containing template at the 3' end. The reverse primer will bind to the complementary strand at the 3' end. The primers will then be used to replicate the specific section of the DNA strands. If the SNP containing template is not present the reaction will not occur as the primer will not be able to bind to the template completely.





Revision as of 07:31, 24 April 2014

BME 100 Spring 2014 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


goPCR

Name: Keerthana Murali
Name: Stephanie DiIullo
Name: Melissa Thomas
Name: Supreet Kaur



LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD
We used the TinkerCAD tool in lab on April 17th to create a design of the changes we would make to the PCR machine. We went to Thingiverse and imported a file of the main heating block of the Open PCR machine. When it was imported into TinkerCAD, we were then able to make adjustments to the main heating block. We also downloaded the main walls of the Open PCR machine and added a LCD screen to the front outside panel.

Our Design
Top View of New Heating Plate
Top View of New Heating Plate
Side View of New Heating Plate
Side View of New Heating Plate
Side View of PCR with New LCD Screen
Side View of PCR
Front View of PCR with New LCD Screen
Front View of PCR


We chose to make two changes to the Open PCR machine. We first added a row of larger holes to the heating block. We also added black markers to designate the larger holes. This addition was made so that the PCR machine could accommodate larger tubes if needed. Secondly, we added a LCD screen to the front side of the Open PCR machine. With this screen, the researcher/scientist will be able to program the cycles directly on the PCR instead of having to connect it to a computer. This will allow for the PCR to be used in new locations.



Feature 1: Disease SNP-Specific Primers

The nucleotide is commonly known as the monomer of DNA. Nucleotide is a compound consisting of a nitrogenous base, phosphate group and a sugar. Polymorphism is the occurrence of two distinct phenotypes found in a population, upon which natural selection occurs. An allele is one of numerous forms of a gene. An allele is also located at a specific position on a specific chromosome. The SNP rs23702, is an allele found in humans (homo sapiens). The exact location of it is 149721690. It is associated with the SUM04 And TAB2 genes. The SUM04 is also called the small ubiquitin like modifier 4 gene and functions as a missence and config reference. The SNP is also associated with Type 1 and Type 2 diabetes. The disease containing allele is ATG.

Primer design

  • Disease SNP-specific Forward Primer: AACCACGGGGATTGTCAGTG
  • Reverse Primer: TTGGTGCCCCTAACAGTCAC

How the primers work: After the DNA is denatured and the temperature is lowered, the disease specific forward primer will bind to the complementary disease containing template at the 3' end. The reverse primer will bind to the complementary strand at the 3' end. The primers will then be used to replicate the specific section of the DNA strands. If the SNP containing template is not present the reaction will not occur as the primer will not be able to bind to the template completely.



Feature 2: Consumables Kit

Along with the PCR, a consumables kit would come with it to decrease the confusion in the experiement and decrease clutter of all the separetely grabbed consumables. Also the tubes will be color coded in order to distinguish different groups of samples used in the experiment. The tube with the primers will also be prelabeled. The tube containing the SYBR green will be included in the set in a black tube. This will allow no light to reach it because it is photosensitive. The tubes will also have a white surface for labeling that will hold marker better. The micro pipetter would be included in the kit but packaged in another box within so it does not break. The kit will also include a pamphlet with the functions of all the materials and PCR tips and tricks. The kit will contain all the materials used in the lab and each material will be packaged seperate and labeled within the kit.

 Consumables Kit:
  -  Colored/white blank label PCR tubes 
  -  Pre labeled primer tubes
  - SYBR green in black tubes
  - Micro Pipette
  - Tips
  - Pamphlet
  - Glass slides

Feature 3: Hardware - PCR Machine & Fluorimeter

PCR MACHINE: The PCR Machine or the Thermal Cycler is used to amplify DNA through the polymerase chain reaction. The machine goes through about 30-40 cycles with three steps that include denaturation, annealing, and extention. The redesigned PCR machine will have bigger holes for the samples to amplify a higher amount of DNA during the process. Also, there will be a LCD screen added to the side of the machine to easily enter the information from the cycles. This would make it easier to collect data since it can be programmed right on the machine instead of having to plug the machine into a computer.

FLUORIMETER: There will be no alteration in the fluorimeter design.


Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

The Bayesian statistics results show that the OpenPCR is not reliable at predicting the particular diabetes we looked at in this experiment. The probability that a patient will develop the disease and get a positive test result after using the PCR and fluorimeter was small and not close to 1. The probability that a patient will not develop a disease and get a negative result was higher than the positive correlation but was still not close to the optimal result of 1. This would not be an optimal method of predicting the diabetes we looked at in this experiment.