BME100 s2014:T Group3 L6

From OpenWetWare
Jump to navigationJump to search
BME 100 Spring 2014 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR COMPANY

Name: Jaquelyn Corr
Name: Maria Morrow
Name: Kazhan Kader
Name: Hannah Spehar
Name: Sayer Aldaady
Name: student


[Instructions: add the name of your team's company and/or product here]


LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD

The TinkerCAD tool is used to build models. We specifically used the TinkerCAD tool to model the PCR machine. We recreated the parts which make up the current machine design, but then added our changes. The changes were made in order to fix the PCR machine weaknesses.

Our Design

[Instructions: Show an image of your TinkerCAD design here]

[Instructions: A short paragraph describing your design. Why did you choose this design? How is it different from the original OpenPCR design?]



Feature 1: Disease SNP-Specific Primers

Background on the disease-associated mutation


A nucleotide is a monomer of a nucleic acid while a polymorphism is when two different phenotypes occur in the same species population. The variation rs237025 is found in the Homo sapien species located on the chromosome 149721690 in position 25. The clinical significance of this variation is categorized as other. This SNP is associated with the SUM04 (small-ubiquitin-related modifier 4) and TAB2 genes. The SUM04 gene attaches to target lysenes and controls the target protein's activity and stability. This SNP is also associated with diseases, particularly diabetes. The non-disease allele (alternative form of gene) is GTG while the disease allele is ATG.


Primer design

  • Disease SNP-specific Forward Primer: AACCACGGGGATTGTCAATG
  • Reverse Primer: TGCAATTTGGTTCCACCACA

How the primers work: [Instructions: explain what makes the primers disease-sequence specific. In other words, explain why the primers will amplify DNA that contains the disease-associated SNP, and will not exponentially amplify DNA that has the non-disease allele.]



Feature 2: Consumables Kit

[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.]

[Instructions: IF your consumables packaging plan addresses any major weakness(es), explain how in an additional paragraph.]


Feature 3: Hardware - PCR Machine & Fluorimeter

[Instructions: Summarize how you will include the PCR machine and fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.]

[Instructions: IF your group has decided to redesign the PCR machine and/or Fluorimeter to address any major weakness(es), explain how in an additional paragraph.]


Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "close to one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]