BME100 s2014:T Group16 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY OUR TEAM Name: Angie Chan Name: Jossel Nkunzi Name: Ryan Hess Name: Alireza Momeni File:JosephSidman.jpg Name: Jospeh Sidman

LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD

TinkerCAD is a software that lets the user create a detailed representation of a product model. Some tools within the program include different shapes (3-dimensional and planar) to be combined with one another, coloring the objects, and creating hollow aspects of the parts. The design is in 3D so it allows the user to create a model used in developing a product. Here, we used TinkerCAD to re-design the lock for the cap in the PCR machine because there has been constant error in tightening the knob at the correct notch.

Our Design

Our newly designed PCR machine can adequately lock the cap that covers the PCR tubes using the new snap-lock that has replaced the knob. This way, we can adequately shut the cap over the tubes and ultimately reduce all light from entering the tube chamber. SYBR Green should not be exposed to light so it is risky to use the knob, in which we could never know when to stop turning. Conversely, if the knob was turned too tightly, this could affect the pressure of the machine physically and damage the walls or other parts of it in the long run. Using a lock instead of a knob would be more convenient and quick for users as well, as it only requires a push of its lever to be snapped in place.

Feature 1: Disease SNP-Specific Primers

Background on the disease-associated mutation

DNA strands are made up of sub-units that are called nucleotides. They are composed of a base, sugar, and phosphate group. A polymorphism is when a single nucleotide that changes during its process of copying. An SNP is a single nucleotide polymorphism, and an example of an SNP is rs237025. This is SNP is present in Homo Sapien species (humans) and are located on 6:149721690 in the DNA strand. It is associated with SUM04 (small ubiquitin-like modifier 4 that encodes small ubiquitin-related modifiers that are attached to proteins and control and target protiens subcellular localization, stability or activity) and TAB2. Some diseases that have been known to be associated with this SNP are type 1 diabetes, VKH syndrome, and rheumatoid arthritis.

The disease associated allele, which is an alternate form of a gene, contains the sequence ATG.

Primer design

• Disease SNP-specific Forward Primer: 5' TGCACGTCCATTGCGATATG
• Reverse Primer: 5' AGTTTTCTAATTGAGAATGC

How the primers work: Primers will bind completely with its complementary template within the DNA strand. Some primers may be specifically for the disease associated sequence so it will only attach to a disease associated section of the DNA strand. If you use the disease-specific primer, they will only attach to the strand of DNA that is paired with the primer. When using it with a non-disease allele, the primer cannot attach and recreate strands. Therefore, no resuls will show, since nothing will be recreated for use to observe.

Feature 2: Consumables Kit

[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.]

[Instructions: IF your consumables packaging plan addresses any major weakness(es), explain how in an additional paragraph.]

Feature 3: Hardware - PCR Machine & Fluorimeter

The PCR machine enables the user to diagnose diseases or observe the sample DNA using Polymerase Chain Reactions. The PCR process consists of mixing the primers (specific to what is being tested), TAQ polymerase, and DNA strands in tubes which are placed into the PCR machine. Using precise fluctuation of temperatures, the targeted sequence, if present, will begin to copy and amplify itself. In this investigation, we used the PCR machine to observe how abundant our sample had the given disease. The fluorimeter is a setup used to determine whether the sample, which was mixed with CYBR Green 1, had the specific DNA or not.

The PCR machine did have some flaws. One major problem was using the screw-knob to secure the PCR tubes. As shown above, a solution was proposed to create a lock at the front of the cap instead of using a knob, which has no way of letting the user know when to stop or keep turning. A lock can adequately close the top without any excess pressures but still completely keep the tubes in a dark environment.

With the fluorimeter, one flaw found was that it could not align perfectly with the smartphones. Some times, the phones could not even focus based on the contrast between the lighted-up drop of DNA and darkness surrounding it. The photo may come out unclear and/or over-saturated in color. Pictures must, however, be as focused and clear as possible since it will need to be further analyzed in Image J. It is important that the phone cameras used in this lab are extremely important in producing the accurate pictures of the drop; otherwise, the DNA count cannot be completed.

Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

Calculation 3 refers to sensitivity of the PCR test. This value shows the probability that a person, who his/her PCR result is positive, has the disease; in other words, the percentage of the people with disease who have been identified as people with disease by PCR test. According to the calculation 3, the value is not close to one, so the probability to predict the disease is not satisfactory. Therefore, there is a significant error percent which shows the reliability of the PCR test to predict the disease is low.

Calculation 4 refers to specificity of the PCR test. This value shows the probability that a person, who his/her PCR result is negative, does not have the disease; in other words, the percentage of healthy people who their PCR result was negative. The value of calculation 4 is closer to one in comparison to the value of calculation 3, but the difference between one and this value is not very small. Since the error in specificity (predict healthy people) is less than the error in sensitivity (predict people with disease), the PCR test is more reliable in detecting healthy people. However, there are usually more healthy people than people with disease, so the number people with disease, who their PCR result was negative, are still noticeable.

As a result, it seems that reliability of PCR test, to detect this kind of disease, is not satisfactory; and other test should be done to determine if a person is healthy or not.