BME100 s2014:T Group16 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY OUR TEAM Name: Angie Chan Name: Jossel Nkunzi Name: Ryan Hess Name: Alireza Momeni File:JosephSidman.jpg Name: Jospeh Sidman

[Instructions: add the name of your team's company and/or product here]

LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD

TinkerCAD is a software that lets the user create a detailed representation of a product model. Some tools within the program include different shapes (3-dimensional and planar) to be combined with one another, coloring the objects, and creating hollow aspects of the parts. The design is in 3D so it allows the user to create a model used in developing a product. Here, we used TinkerCAD to re-design the lock for the cap in the PCR machine because there has been constant error in tightening the knob at the correct notch.

Our Design

Our newly designed PCR machine can adequately lock the cap that covers the PCR tubes using the new snap-lock that has replaced the knob. This way, we can adequately shut the cap over the tubes and ultimately reduce all light from entering the tube chamber. SYBR Green should not be exposed to light so it is risky to use the knob, in which we could never know when to stop turning. Conversely, if the knob was turned too tightly, this could affect the pressure of the machine physically and damage the walls or other parts of it in the long run. Using a lock instead of a knob would be more convenient and quick for users as well, as it only requires a push of its lever to be snapped in place.

Feature 1: Disease SNP-Specific Primers

Background on the disease-associated mutation

DNA strands are made up of sub-units that are called nucleotides. They are composed of a base, sugar, and phosphate group. A polymorphism is when a single nucleotide that changes during its process of copying. An SNP is a single nucleotide polymorphism, and an example of an SNP is rs237025. This is SNP is present in Homo Sapien species (humans) and are located on 6:149721690 in the DNA strand. It is associated with SUM04 (small ubiquitin-like modifier 4 that encodes small ubiquitin-related modifiers that are attached to proteins and control and target protiens subcellular localization, stability or activity) and TAB2. Some diseases that have been known to be associated with this SNP are type 1 diabetes, VKH syndrome, and rheumatoid arthritis.

The disease associated allele, which is an alternate form of a gene, contains the sequence ATG.

Primer design

• Disease SNP-specific Forward Primer: 5' TGCACGTCCATTGCGATATG
• Reverse Primer: 5' AGTTTTCTAATTGAGAATGC

How the primers work: Primers will bind completely with its complementary template within the DNA strand. Some primers may be specifically for the disease associated sequence so it will only attach to a disease associated section of the DNA strand. If you use the disease-specific primer, they will only attach to the strand of DNA that is paired with the primer. When using it with a non-disease allele, the primer cannot attach and recreate strands. Therefore, no resuls will show, since nothing will be recreated for use to observe.

Feature 2: Consumables Kit

[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.]

[Instructions: IF your consumables packaging plan addresses any major weakness(es), explain how in an additional paragraph.]

Feature 3: Hardware - PCR Machine & Fluorimeter

[Instructions: Summarize how you will include the PCR machine and fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.]

The PCR machine enables the user to diagnose diseases or observe the sample DNA using Polymerase Chain Reactions. The PCR process consists of mixing the primers (specific to what is being tested), TAQ polymerase, and DNA strands in tubes which are placed into the PCR machine. Using precise fluctuation of temperatures, the targeted sequence, if present, will begin to copy and amplify itself. In this investigation, we used the PCR machine to observe how abundant our sample had the given disease. The fluorimeter is a setup used to determine whether the sample, which was mixed with CYBR Green 1, had the specific DNA or not.

The PCR machine did have some flaws. One major problem was using the screw-knob to secure the PCR tubes. As shown above, a solution was proposed to create a lock at the front of the cap instead of using a knob, which has no way of letting the user know when to stop or keep turning. A lock can adequately close the top without any excess pressures but still completely keep the tubes in a dark environment.

With the fluorimeter, one flaw found was that it could not align perfectly with the smartphones. Some times, the phones could not even focus based on the contrast between the lighted-up drop of DNA and darkness surrounding it. The photo may come out unclear and/or over-saturated in color. Pictures must, however, be as focused and clear as possible since it will need to be further analyzed in Image J. It is important that the phone cameras used in this lab are extremely important in producing the accurate pictures of the drop; otherwise, the DNA count cannot be completed.

Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "close to one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]