BME100 s2014:T Group13 L6

From OpenWetWare
Jump to navigationJump to search
BME 100 Spring 2014 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR COMPANY

Name: Mikaela Hall
Name: Sarah McBryan
Name: Avery Witting
Name: Dan Saunders

Company name: TEST IT Product: InstaPCR


LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD

The TinkerCAD tool is a simplified, online implementation of CAD software. It creates 3-dimensional models that can be shaped. These models can be saved as files (*.stl, *.obj, etc.) that are ready to be 3D printed or a 3D print may be ordered from a third party service. We used TinkerCAD to design several changes to the OpenPCR system for use in DNA testing.


Our Design

[Instructions: Show an image of your TinkerCAD design here]

[Instructions: A short paragraph describing your design. Why did you choose this design? How is it different from the original OpenPCR design?]



Feature 1: Disease SNP-Specific Primers

Background on the disease-associated mutation

A nucleotide consists of base pairs, phosphate, and a sugar group. It is an organic molecule that serves as the monomers of a nucleic acid. A polymorphism, or a single nucleotide polymorphism, is a common variation in a sequence of DNA. It means that in a single strand of DNA, one letter of a single nucleotide is different in a given genome. The rs237025 is one such single nucleotide polymorphism. It is a variation found in homosapiens, or humans. The variation is located on chromosome 6:149721690 and is associated with the SUMO4 and TAB2 genes. SUMO4 is a small ubiquitin-like modifier. It controls target protein’s subcellular localization, stability, and activity. The clinical significance of this single nucleotide polymorphism is listed as other on according to the NCBI database, but there are a number of different diseases that have been linked to it such as type 1 diabetes, rheumatoid arthritis, psoriasis vugaris, and type 2 diabetes. An allele is one of the variant forms of a gene at a particular location on a chromosome. The disease-associated allele, in this case, contains sequence GTG-ATG.

All this information was found through http://www.ncbi.nlm.nih.gov.


Primer design

  • Disease SNP-specific Forward Primer: AACCACGGGGATTGTCAGTG
  • Reverse Primer: AGTTTTCTAATTGAGAATGC


How the primers work:

Primers work by attaching themselves to specific sequences of DNA. The forward primer attaches itself to the 5’ end of the single stranded DNA and ends at the nucleotide from the disease-associated allele. The reverse primer attaches itself to the 5’ end of the other single stranded DNA sequence. It attaches itself directly in the reverse of the forward primer. Once these primers attach themselves to the DNA, the taq polymerase attaches to the primers and can start building new strands of DNA based on the template information outlined by these primers. The primers only amplify the DNA that contains the disease-associated SNP because they only bind to the disease-specific alleles. If there is only a non-disease allele, then the primers won’t recognize the sequence and will not be able to bind to them. Because they do not bind to the non-disease alleles, the polymerase doesn’t replicate the sequences and the DNA strands are not amplified.

Information taken from the BME 100 Lab Workbook pg 13.



Feature 2: Consumables Kit

The Consumables Kit will include all of the materials needed to do one full PCR experiment. Included in the Consumables Kit will be:

  • 10 slides to which will have a rough surface and a smooth surface to each slide
  • 250 micropipette tips
  • 1 micropipette
  • 50 micro-tubes with lids
  • 20 large-tubes with lids
  • A marker
  • A container of 20mL of SYBR Green solution
  • A container of 10mL of distilled water
  • A container of 20mL of PCR reaction mix containing: Taq DNA polymerase, Magnesium Chloride, and dNTP
  • One orange biohazard bag
  • 1 meter of paper towels

The Consumables Kit will be organized in such a fashion that every object is easily accessed. All of the materials will be specially fit into a plastic mold at the bottom of the box that will hold each respective material. An example of this will be the micropipette. The micropipette has a specific shape. The plastic mold in the bottom of the box will have the exact shape of the micropipette as well as the name “Micropipette” labeled in the plastic. This will eliminate confusion about what material is what. This will be especially useful when trying to identify all of the solutions initially.



Feature 3: Hardware - PCR Machine & Fluorimeter

[Instructions: Summarize how you will include the PCR machine and fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.]

[Instructions: IF your group has decided to redesign the PCR machine and/or Fluorimeter to address any major weakness(es), explain how in an additional paragraph.]

We will include the PCR Machine and Fluorimeter by having it in a separate box than the Consumables Kit. By doing this, there will be less confusion about what the PCR Machine is and the Fluorimeter is. There will be a cardboard barrier between the Fluorimeter and the PCR machine. The PCR machine will be wrapped with white paper, and the Fluorimeter will be wrapped with black paper so that there will not be any confusion.


Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

Calculation 3 was done to find the probability of a patient developing the disease, given a positive final test conclusion. This probability was relatively low, implying that false positives would be an issue with this disease testing method.
Calculation 4 was performed to find the probability of a patient not developing the disease, given a negative final test conclusion. This probability was much closer to one. This implies that most patients who receive a negative final test conclusion will not develop the disease, but some still will.
The probabilities were low enough that it could be said that PCR is not very reliable for predicting this disease.


[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "close to one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]