BME100 s2014:T Group13 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY MedExpress Name: Mikaela Hall Name: Sarah McBryan Name: Avery Witting Name: Dan Saunders Company name: MedExpress Product: InstaPCR LAB 6 WRITE-UP Computer-Aided Design InstaPCR with heating plate improvement highlighted. TinkerCAD The TinkerCAD tool is a simplified, online implementation of CAD software. It creates 3-dimensional models that can be shaped. These models can be saved as files (*.stl, *.obj, etc.) that are ready to be 3D printed or a 3D print may be ordered from a third party service. We used TinkerCAD to design several changes to the OpenPCR system for use in DNA testing. Our Design The InstaPCR improves upon existing technology provided by the OpenPCR system. We increase the surface area of the heating plate. This will more evenly distribute heat throughout the samples. A more even heat distribution is more energy efficient and provides quicker heating of the samples. InstaPCR is therefore a faster alternative to OpenPCR. Feature 1: Disease SNP-Specific Primers Background on the disease-associated mutation A nucleotide consists of base pairs, phosphate, and a sugar group. It is an organic molecule that serves as the monomers of a nucleic acid. A polymorphism, or a single nucleotide polymorphism, is a common variation in a sequence of DNA. It means that in a single strand of DNA, one letter of a single nucleotide is different in a given genome. The rs237025 is one such single nucleotide polymorphism. It is a variation found in homosapiens, or humans. The variation is located on chromosome 6:149721690 and is associated with the SUMO4 and TAB2 genes. SUMO4 is a small ubiquitin-like modifier. It controls target protein’s subcellular localization, stability, and activity. The clinical significance of this single nucleotide polymorphism is listed as other on according to the NCBI database, but there are a number of different diseases that have been linked to it such as type 1 diabetes, rheumatoid arthritis, psoriasis vugaris, and type 2 diabetes. An allele is one of the variant forms of a gene at a particular location on a chromosome. The disease-associated allele, in this case, contains sequence GTG-ATG. All this information was found through http://www.ncbi.nlm.nih.gov. Primer design Disease SNP-specific Forward Primer: AACCACGGGGATTGTCAGTG Reverse Primer: AGTTTTCTAATTGAGAATGC How the primers work: Primers work by attaching themselves to specific sequences of DNA. The forward primer attaches itself to the 5’ end of the single stranded DNA and ends at the nucleotide from the disease-associated allele. The reverse primer attaches itself to the 5’ end of the other single stranded DNA sequence. It attaches itself directly in the reverse of the forward primer. Once these primers attach themselves to the DNA, the taq polymerase attaches to the primers and can start building new strands of DNA based on the template information outlined by these primers. The primers only amplify the DNA that contains the disease-associated SNP because they only bind to the disease-specific alleles. If there is only a non-disease allele, then the primers won’t recognize the sequence and will not be able to bind to them. Because they do not bind to the non-disease alleles, the polymerase doesn’t replicate the sequences and the DNA strands are not amplified. Information taken from the BME 100 Lab Workbook pg 13. Feature 2: Consumables Kit The Consumables Kit will include all of the materials needed to do one full PCR experiment. Included in the Consumables Kit will be: 10 slides to which will have a rough surface and a smooth surface to each slide 250 micropipette tips 1 micropipette 50 micro-tubes with lids 20 large-tubes with lids A marker A container of 20mL of SYBR Green solution A container of 10mL of distilled water A container of 20mL of PCR reaction mix containing: Taq DNA polymerase, Magnesium Chloride, and dNTP One orange biohazard bag 1 meter of paper towels The Consumables Kit will be organized in such a fashion that every object is easily accessed. All of the materials will be specially fit into a plastic mold at the bottom of the box that will hold each respective material. An example of this will be the micropipette. The micropipette has a specific shape. The plastic mold in the bottom of the box will have the exact shape of the micropipette as well as the name “Micropipette” labeled in the plastic. This will eliminate confusion about what material is what. This will be especially useful when trying to identify all of the solutions initially. Feature 3: Hardware - PCR Machine & Fluorimeter Our PCR Machine, Fluorimeter, and Consumables kit will all come in separate, clearly labeled boxes. Each one of these will need to be purchased separately. The PCR machine and fluorimeter will come pre-assembled and ready to use almost immediately. The only thing that the consumer will need to do is make sure that the PCR Machine and Fluorimeter are assembled correctly together by using a booklet contained within each package. This booklet will include pictures and instructions that will guide the consumer for setting up the machines together and proper usage. There will be a small camera pre-placed within the fluorimeter so no smartphone will be necessary. The reason for this is to reduce confusion of how to set up the fluorimeter for the consumer. We redesigned the PCR machine to have a larger heating plate to create more even heat distribution. We also redesigned the fluorimeter to include the camera within the machine to address the weakness of having to provide your own photographic equipment and change settings on the smartphone camera. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach Calculation 3 was done to find the probability of a patient developing the disease, given a positive final test conclusion. This probability was relatively low, implying that false positives would be an issue with this disease testing method. Calculation 4 was performed to find the probability of a patient not developing the disease, given a negative final test conclusion. This probability was much closer to one. This implies that most patients who receive a negative final test conclusion will not develop the disease, but some still will. The probabilities were low enough that it could be said that PCR is not very reliable for predicting this disease.