BME100 s2014:T Group13 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Mikaela Hall Name: Sarah McBryan Name: Avery Witting Name: Dan Saunders [Instructions: add the name of your team's company and/or product here] LAB 6 WRITE-UP Computer-Aided Design TinkerCAD [Instructions: A short summary (up to five sentences) of the TinkerCAD tool and how you used it in lab on November 20th] Our Design [Instructions: Show an image of your TinkerCAD design here] [Instructions: A short paragraph describing your design. Why did you choose this design? How is it different from the original OpenPCR design?] Feature 1: Disease SNP-Specific Primers Background on the disease-associated mutation A nucleotide consists of base pairs, phosphate, and a sugar group. It is an organic molecule that serves as the monomers of a nucleic acid. A polymorphism, or a single nucleotide polymorphism, is a common variation in a sequence of DNA. It means that in a single strand of DNA, one letter of a single nucleotide is different in a given genome. The rs237025 is one such single nucleotide polymorphism. It is a variation found in homosapiens, or humans. The variation is located on chromosome 6:149721690 and is associated with the SUMO4 and TAB2 genes. SUMO4 is a small ubiquitin-like modifier. It controls target protein’s subcellular localization, stability, and activity. The clinical significance of this single nucleotide polymorphism is listed as other on according to the NCBI database, but there are a number of different diseases that have been linked to it such as type 1 diabetes, rheumatoid arthritis, psoriasis vugaris, and type 2 diabetes. An allele is one of the variant forms of a gene at a particular location on a chromosome. The disease-associated allele, in this case, contains sequence GTG-ATG. All this information was found through http://www.ncbi.nlm.nih.gov. Primer design Disease SNP-specific Forward Primer: AACCACGGGGATTGTCAGTG Reverse Primer: AGTTTTCTAATTGAGAATGC How the primers work: Primers work by attaching themselves to specific sequences of DNA. The forward primer attaches itself to the 5’ end of the single stranded DNA and ends at the nucleotide from the disease-associated allele. The reverse primer attaches itself to the 5’ end of the other single stranded DNA sequence. It attaches itself directly in the reverse of the forward primer. Once these primers attach themselves to the DNA, the taq polymerase attaches to the primers and can start building new strands of DNA based on the template information outlined by these primers. The primers only amplify the DNA that contains the disease-associated SNP because they only bind to the disease-specific alleles. If there is only a non-disease allele, then the primers won’t recognize the sequence and will not be able to bind to them. Because they do not bind to the non-disease alleles, the polymerase doesn’t replicate the sequences and the DNA strands are not amplified. Information taken from the BME 100 Lab Workbook pg 13. Feature 2: Consumables Kit Avery will do this [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness(es), explain how in an additional paragraph.] Feature 3: Hardware - PCR Machine & Fluorimeter [Instructions: Summarize how you will include the PCR machine and fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine and/or Fluorimeter to address any major weakness(es), explain how in an additional paragraph.] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "close to one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]