BME100 f2014:Group3 L5: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
 
(26 intermediate revisions by 4 users not shown)
Line 30: Line 30:
'''Smart Phone Camera Settings'''<br>
'''Smart Phone Camera Settings'''<br>
<!-- The type of smart phone you used and how you adjusted the camera settings, if applicable. If you used more than one phone, make an additional list. -->
<!-- The type of smart phone you used and how you adjusted the camera settings, if applicable. If you used more than one phone, make an additional list. -->
* Type of Smartphone:
* Type of Smartphone: iPhone 5
** Flash:
** Flash: off
** ISO setting:
** ISO setting: default
** White Balance:  
** White Balance: default
** Exposure:
** Exposure: default
** Saturation:
** Saturation: default
** Contrast:
** Contrast: default




'''Calibration'''<br>
'''Calibration'''<br>
<!-- INSTRUCTIONS: In the space below, briefly describe how to set up your camera in front of the fluorimeter. Add a PHOTO of this set-up for bonus points. -->
<!-- INSTRUCTIONS: In the space below, briefly describe how to set up your camera in front of the fluorimeter. Add a PHOTO of this set-up for bonus points. -->
* Using the switch for Blue LED, turn on the excitation light.
* Turn on smartphone camera and record camera settings used.
* Place smartphone on phone cradle and, using plastic trays, adjust the height of the fluorimeter so that the camera captures an image of the drop from the side.
* Adjust the position of the smartphone cradle so that the camera is as close to the drop as possible while still remaining focused on the drop.
* Using a ruler, record the distance between the smartphone camera and the drop.


<!-- INSTRUCTIONS: Type the distance between your phone cradle and the drop after the equal sign. -->
<!-- INSTRUCTIONS: Type the distance between your phone cradle and the drop after the equal sign. -->
* Distance between the smart phone cradle and drop =


* Distance between our smartphone cradle and drop = 4.5 cm


'''Solutions Used for Calibration'''
'''Solutions Used for Calibration'''
{| {{table}} width=700
{| {{table}} width=700
|-
|Initial Concentration of 2X calf Thymus DNA Solution (µg/mL) || Volume of the 2X DNA solution (µL) || Volume of the SYBR Green 1 Dye Solution (µL) || Final DNA concentration in SYBR Green 1 Solution (µg/mL)
|-
| 5 || 80 || 80 || 2.5
|-
| 2 || 80 || 80 || 1
|-
|-
| row 1 cell 1 || row 1 cell 2 || row 1 cell 3 || row 1 cell 4
| 1 || 80 || 80 || 0.5
|-
|-
| row 2 cell 1 || row 2 cell 2 || row 2 cell 3 || row 2 cell 4
| 0.5 || 80 || 80 || 0.25
|-
|-
| row 3 cell 1 || row 3 cell 2 || row 3 cell 3 || row 3 cell 4
| 0.25 || 80 || 80 || 0.125
|-
| 0 || 80 || 80 || 0
|}
|}


<!-- Add more rows and cells as needed. -->
<!-- Add more rows and cells as needed. -->


'''Bonus'''


[[Image:IMG_4178.JPG|300px]]


'''Placing Samples onto the Fluorimeter'''
This picture shows our smartphone resting in the phone cradle, 4.5 cm away from the slide where the drop is placed.
# ''[Instructions: Step one, in your OWN words]''
 
# ''[Instructions: Step two, in your own words]''
[[Image:IMG_4177.JPG|300px]]
# ''[Instructions: Step three, in your own words]''
 
# ''[Instructions: Step etc., in your own words]''
This picture shows our setup in the black box that will be used to block out light. Once the camera's timer is set off, the front flap of the box will be closed so no light interferes with the picture.
 
 
 
 
 
 
'''Placing Samples onto the Fluorimeter''' <br>
''1. Power on the Fluorimeter so that the light appears. Adjust the slide until the light is shining between two of the indentations on the slide. It should align in the middle. <br>
''2. Obtain a micro pipette and adjust it to 80mL. Get a new tip for the pipette, and pipette 80mL of the SYBR Green I on the slide in between the dots from the previous step. Dispose of the tip into a sharps waste container. <br>
''3. Repeat the last step with 80mL of the DNA sample. Pipette the DNA into the SYBR Green I dot. <br>
''4. Using a smartphone camera with a timer, place it into the phone cradle at 4.5 centimeters away from the location of the drop (following the calibration settings). Close the box to enclose darkness around the sample. When the 3 second timer goes off and the picture is taken, retrieve the camera and store this picture. Repeat this three times. <br>
''5. Remove the sample from the slide using the micro pipette. Dispose of the sample into the cup. Remove the tip into the cup. <br>
''6. Push the slide so that a new set of dots that have not been exposed to the sample are available. Realign like in step one. Repeat steps two through five using the next sample. <br>


<br>
<br>
Line 74: Line 103:
<!-- INSTRUCTIONS: (1) Show ONE image where you drew a circle around the droplet with the freehand tool for any sample with *no* DNA. (2) Show ONE image where you drew a circle around the droplet with the freehand tool for a sample *with* DNA (positive signal). -If you include more than two images, you will not receive any additional credit. -->
<!-- INSTRUCTIONS: (1) Show ONE image where you drew a circle around the droplet with the freehand tool for any sample with *no* DNA. (2) Show ONE image where you drew a circle around the droplet with the freehand tool for a sample *with* DNA (positive signal). -If you include more than two images, you will not receive any additional credit. -->


Negative sample: [[Image:Bme lab 5 negative.PNG|300px]]
* It should be noted that there was an error in our experiment causing our negative sample to glow green indicating a positive sample. Therefore, we do not have any drops that are of a truly negative sample.


Positive sample: [[Image:Bme lab 5 positive.PNG|300px]]


'''Image J Values for All Calibrator Samples'''  
'''Image J Values for All Calibrator Samples'''  
Line 80: Line 113:




TABLE GOES HERE
[[Image:Bme lab 5 table 1.PNG|400px]]
 
'''Additional Tables used for Calculations'''
 
[[Image:bme lab 5 table 2.PNG|400px]]
 
[[Image:bme lab 5 table 3.PNG|400px]]


[[Image:bme lab 5 table 4.PNG|400px]]
[[Image:bme lab 5 table 5.PNG|400px]]
[[Image:bme lab 5 table 6.PNG|400px]]


'''Calibration curve'''<br>
'''Calibration curve'''<br>
<!-- INSTRUCTIONS: Place an image of your Excel plot with a line of best fit here. -->
[[Image:Bme lab 5 graph 1.PNG|400px]]




'''PCR Results Summary'''
'''PCR Results Summary'''
<!-- INSTRUCTIONS: You completed 8 PCR reactions and used the SYBR Green I staining and imaging technique to measure the amount of amplified DNA in each PCR reaction. You used a standard curve (based on known concentrations of calf thymus DNA) to convert INTDEN values into DNA concentration. Your positive control and negative control samples should be used as '''threshold''' values for determining whether an unknown (patient) sample is truly positive or negative. Replace the underscore with your claculated initial concentration values.-->
<!-- INSTRUCTIONS: You completed 8 PCR reactions and used the SYBR Green I staining and imaging technique to measure the amount of amplified DNA in each PCR reaction. You used a standard curve (based on known concentrations of calf thymus DNA) to convert INTDEN values into DNA concentration. Your positive control and negative control samples should be used as '''threshold''' values for determining whether an unknown (patient) sample is truly positive or negative. Replace the underscore with your claculated initial concentration values.-->
* Our positive control PCR result was ____ μg/mL
* Our positive control PCR result was 8.938 μg/mL
* Our negative control PCR result was ____ μg/mL
* Our negative control PCR result was 13.115 μg/mL


<u>Observed results</u>
<u>Observed results</u>
<!-- INSTRUCTIONS: Replace the underscore with each patient ID. After the colon, write both a qualitative (what the images looked like) and a quantitative description (μg/mL) of what you observed -->
<!-- INSTRUCTIONS: Replace the underscore with each patient ID. After the colon, write both a qualitative (what the images looked like) and a quantitative description (μg/mL) of what you observed -->
* Patient _____ :  
* Patient 19452 : The values of the three separate trials were 5.94, 6.03, 4.90 μg/mL. The average of these trials is 5.62 μg/mL. The drops were mostly green, though the very tops of the drops had a less intense green color than that of the positive control.
* Patient _____ :
* Patient 37145 : The values of the three separate trials were 3.51, 4.58, 6.15 μg/mL. The average of these trials is 4.75 μg/mL. The drops had some green glow to them, but the top half was far less green than the positive control and even that of the other patient.


<u>Conclusions</u>
<u>Conclusions</u>
<!-- INSTRUCTIONS: Compare each patient's results to the positive control value and the negative control value. Draw a final conclusion for each patient (positive or negative) and explain why you made that conclusion. -->
<!-- INSTRUCTIONS: Compare each patient's results to the positive control value and the negative control value. Draw a final conclusion for each patient (positive or negative) and explain why you made that conclusion. -->
* Patient _____ :
* Patient 19452 : inconclusive
* Patient _____ :
* Patient 37145 : inconclusive
We were unable to draw conclusions about either of our patients because there was an error in our negative control. It appears that somewhere during the experiment's course the negative sample was contaminated with a positive strain of DNA because our negative control drop glowed green, which it should not have done. Because of this error, we are unable to draw any conclusions from our data.




Line 110: Line 155:
'''Background: About the Disease SNP'''
'''Background: About the Disease SNP'''
<!-- INSTRUCTIONS: This content is from PCR Lab D. Write a summary, at least five sentences long, about the disease SNP in your own words. -->
<!-- INSTRUCTIONS: This content is from PCR Lab D. Write a summary, at least five sentences long, about the disease SNP in your own words. -->
A nucleotide/s is structural components of DNA and RNA (series of building blocks if you will). DNA and RNA assembled of individual nucleotides.  Nucleotides are consisting of three organic molecules; a 5 carbon sugar (Deoxyribose or ribose), a phosphate group and one of four set of nitrogenous base (A, T, C and G).Poly means two or more; morphs means, slow variation within a same species. Therefore, polymorphism is an existence of two or more distinct/obvious different phenotype among the populations of a same species (genus if you will). It is found in the Homo Sapiens species. The chromosome variation is located on; 21:34370656. Of this SNP the clinical significance is pathogenic. The gene associated with SNP is KCNE2. The disease associated with this SNP is congenital long QT syndromes (LQTSs).




Line 115: Line 162:
<!-- INSTRUCTIONS: Write a short summary of the results of your primer test. Underneath your summary, include a screen capture of the results web page. You may crop the image so that it only includes the relevant information. -->
<!-- INSTRUCTIONS: Write a short summary of the results of your primer test. Underneath your summary, include a screen capture of the results web page. You may crop the image so that it only includes the relevant information. -->


What does KCNE2 stand for?  Potassium voltage-gated channel, Isk-related family, member 2
Briefly describe the molecular function of this gene:
The KCNH2 gene in human sapiens DNA, codes for a protein that rise to a potassium ion channel. This potassium ion channel is responsible to regulate electrical current activity of the heart beats. If for some reason (such as mutation in a single nucleotide), the functionality of this potassium ion channel inhibited or changed (i.e. lost or gain functionality of ion channel) it may cause a mortal disorder know as long QT syndrome. Patients associated with long QT syndrome, have a potential risk of fatal cardiac arrhythmias or sudden death.
What is an allele? An alternative form or different version of a gene, called an allele. Furthermore, these diverse alleles may rise to different phenotypic traits.
The disease-associated allele contains what sequence? CTC
The numerical position of the SNP is: 34370656
Non-disease forward primer (20 nt): CATGGTGATGATTGGAATGT
The numerical position exactly200 bases to the right of the disease SNP is: 34370856
Non-disease reverse primer (20 nt): CCCTTATCAGGGGGACATTT


Disease forward primer (20 nt): CATGGTGATGATTGGAATGC


Disease reverse primer (20 nt): CCCTTATCAGGGGGACATTT


[[Image:FARa1.png]]
[[Image:FARa2.png]]
[[Image:FARb.png]]


<!-- Do not edit below this line -->
<!-- Do not edit below this line -->
|}
|}

Latest revision as of 21:14, 20 November 2014

BME 100 Fall 2014 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR TEAM

Name: Marissa Seelhammer
Name: Brianna Denuit
Name: Farhad Eghbalian
Name: Shane Mitchell
Name: Catherine Piatak
Name: Nivenka Mahesh


LAB 5 WRITE-UP

Procedure

Smart Phone Camera Settings

  • Type of Smartphone: iPhone 5
    • Flash: off
    • ISO setting: default
    • White Balance: default
    • Exposure: default
    • Saturation: default
    • Contrast: default


Calibration

  • Using the switch for Blue LED, turn on the excitation light.
  • Turn on smartphone camera and record camera settings used.
  • Place smartphone on phone cradle and, using plastic trays, adjust the height of the fluorimeter so that the camera captures an image of the drop from the side.
  • Adjust the position of the smartphone cradle so that the camera is as close to the drop as possible while still remaining focused on the drop.
  • Using a ruler, record the distance between the smartphone camera and the drop.


  • Distance between our smartphone cradle and drop = 4.5 cm

Solutions Used for Calibration

Initial Concentration of 2X calf Thymus DNA Solution (µg/mL) Volume of the 2X DNA solution (µL) Volume of the SYBR Green 1 Dye Solution (µL) Final DNA concentration in SYBR Green 1 Solution (µg/mL)
5 80 80 2.5
2 80 80 1
1 80 80 0.5
0.5 80 80 0.25
0.25 80 80 0.125
0 80 80 0


Bonus

This picture shows our smartphone resting in the phone cradle, 4.5 cm away from the slide where the drop is placed.

This picture shows our setup in the black box that will be used to block out light. Once the camera's timer is set off, the front flap of the box will be closed so no light interferes with the picture.




Placing Samples onto the Fluorimeter
1. Power on the Fluorimeter so that the light appears. Adjust the slide until the light is shining between two of the indentations on the slide. It should align in the middle.
2. Obtain a micro pipette and adjust it to 80mL. Get a new tip for the pipette, and pipette 80mL of the SYBR Green I on the slide in between the dots from the previous step. Dispose of the tip into a sharps waste container.
3. Repeat the last step with 80mL of the DNA sample. Pipette the DNA into the SYBR Green I dot.
4. Using a smartphone camera with a timer, place it into the phone cradle at 4.5 centimeters away from the location of the drop (following the calibration settings). Close the box to enclose darkness around the sample. When the 3 second timer goes off and the picture is taken, retrieve the camera and store this picture. Repeat this three times.
5. Remove the sample from the slide using the micro pipette. Dispose of the sample into the cup. Remove the tip into the cup.
6. Push the slide so that a new set of dots that have not been exposed to the sample are available. Realign like in step one. Repeat steps two through five using the next sample.


Data Analysis

Representative Images of Negative and Positive Samples

Negative sample:

  • It should be noted that there was an error in our experiment causing our negative sample to glow green indicating a positive sample. Therefore, we do not have any drops that are of a truly negative sample.

Positive sample:

Image J Values for All Calibrator Samples


Additional Tables used for Calculations

Calibration curve


PCR Results Summary

  • Our positive control PCR result was 8.938 μg/mL
  • Our negative control PCR result was 13.115 μg/mL

Observed results

  • Patient 19452 : The values of the three separate trials were 5.94, 6.03, 4.90 μg/mL. The average of these trials is 5.62 μg/mL. The drops were mostly green, though the very tops of the drops had a less intense green color than that of the positive control.
  • Patient 37145 : The values of the three separate trials were 3.51, 4.58, 6.15 μg/mL. The average of these trials is 4.75 μg/mL. The drops had some green glow to them, but the top half was far less green than the positive control and even that of the other patient.

Conclusions

  • Patient 19452 : inconclusive
  • Patient 37145 : inconclusive

We were unable to draw conclusions about either of our patients because there was an error in our negative control. It appears that somewhere during the experiment's course the negative sample was contaminated with a positive strain of DNA because our negative control drop glowed green, which it should not have done. Because of this error, we are unable to draw any conclusions from our data.




SNP Information & Primer Design

Background: About the Disease SNP

A nucleotide/s is structural components of DNA and RNA (series of building blocks if you will). DNA and RNA assembled of individual nucleotides. Nucleotides are consisting of three organic molecules; a 5 carbon sugar (Deoxyribose or ribose), a phosphate group and one of four set of nitrogenous base (A, T, C and G).Poly means two or more; morphs means, slow variation within a same species. Therefore, polymorphism is an existence of two or more distinct/obvious different phenotype among the populations of a same species (genus if you will). It is found in the Homo Sapiens species. The chromosome variation is located on; 21:34370656. Of this SNP the clinical significance is pathogenic. The gene associated with SNP is KCNE2. The disease associated with this SNP is congenital long QT syndromes (LQTSs).


Primer Design and Testing

What does KCNE2 stand for? Potassium voltage-gated channel, Isk-related family, member 2

Briefly describe the molecular function of this gene: The KCNH2 gene in human sapiens DNA, codes for a protein that rise to a potassium ion channel. This potassium ion channel is responsible to regulate electrical current activity of the heart beats. If for some reason (such as mutation in a single nucleotide), the functionality of this potassium ion channel inhibited or changed (i.e. lost or gain functionality of ion channel) it may cause a mortal disorder know as long QT syndrome. Patients associated with long QT syndrome, have a potential risk of fatal cardiac arrhythmias or sudden death.

What is an allele? An alternative form or different version of a gene, called an allele. Furthermore, these diverse alleles may rise to different phenotypic traits.

The disease-associated allele contains what sequence? CTC

The numerical position of the SNP is: 34370656

Non-disease forward primer (20 nt): CATGGTGATGATTGGAATGT

The numerical position exactly200 bases to the right of the disease SNP is: 34370856

Non-disease reverse primer (20 nt): CCCTTATCAGGGGGACATTT

Disease forward primer (20 nt): CATGGTGATGATTGGAATGC

Disease reverse primer (20 nt): CCCTTATCAGGGGGACATTT

Retrieved from "https://openwetware.org/mediawiki/index.php?title=BME100_f2014:Group3_L5&oldid=845016"