BME100 f2013:W900 Group6 L6: Difference between revisions
Line 57: | Line 57: | ||
* Cancer-specific Reverse Primer: GGTCCTAAAAACTCTTACAC | * Cancer-specific Reverse Primer: GGTCCTAAAAACTCTTACAC | ||
How the primers work: It beings with identifying the "target sequence," in this case the cancer-associated SNP rs17879961 . The primers | How the primers work: It beings with identifying the "target sequence," in this case the cancer-associated SNP rs17879961 . The primers specifically binds to the 3' end of the target sequence. Note that primers will only bind to the sequences that are complimentary to their own sequence. The primers then direct a DNA polymerase to synthesize the complementary DNA strands. Only DNA with the target sequence will be copied, because DNA polymerase can only copy the molecules with the primer attached; this is the reason why the non-cancer alleles will not be amplified. | ||
With each PCR cycle | With each PCR cycle, partial target sequences and double stranded molecules, which contain only the target sequence, are “created” (also known as “amplified”). As the cycles continue, more target sequences of double stranded molecules (with the target sequence: rs17879961) and partial target sequences are produced. Consequently, with each PCR cycle, the number of strands with the target sequence grows exponentially (2^n). Essentially, after all cycles are complete, the end result will be a large number of pure target sequence molecules that only code for the SNP rs17879961 (the cancer-associated marker). | ||
==Feature 2: Consumables Kit== | ==Feature 2: Consumables Kit== |
Revision as of 20:42, 26 November 2013
BME 100 Fall 2013 | Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | |||||
OUR COMPANY
LAB 6 WRITE-UPComputer-Aided DesignTinkerCAD On November 20th, we worked with the TinkerCAD tool to design our improvements for the PCR-based Diagnostic Test. We used the TinkerCAD software to redesign the PCR Tubes, the Open PCR machine, the phone holder for the fluorimeter and the packaging for these devices. First, we worked on the PCR Tubes and made them blacked out in order to prevent the light from bleaching the SYBR green. We also added measurement markings on the sides of the PCR tubes in order to easily identify the volume of the solution in the tube. We also used the TinkerCAD tool to design the packaging for the device as well as the PCR machine (which was more of a software fix than an actual design flaw).
One possible way to use the TinkerCAD tool for something practical is the camera holder aspect of the fluorimeter. TinkerCAD allows us to design an object easily and is a free application, so we can design a project without the need to buy materials and supplies for the prototype. When the model is complete, TinkerCAD allows users to print off the design via 3D printer. We changed the design of the camera holder because the one used in the previous lab would not hold the phone in an upright position as it did not directly fir the phone. We developed a new design for the phone holder by making it adjustable so that it is compatible with various models of phones.
Feature 1: Cancer SNP-Specific PrimersBackground on the cancer-associated mutation Rs17879961 is a pathogenic single nucleotide polymorphism (SNP) that is found in Homo Sapiens. This single nucleotide polymorphism (SNP) is found in the 22nd chromosome of the 23 that Homo Sapiens contain. Rs17879961 affects the gene Checkpoint Kinase 2 (Chek2). This gene is a cell cycle checkpoint regulator that suppresses tumors and halts cell cycle progression when DNA is damaged.
How the primers work: It beings with identifying the "target sequence," in this case the cancer-associated SNP rs17879961 . The primers specifically binds to the 3' end of the target sequence. Note that primers will only bind to the sequences that are complimentary to their own sequence. The primers then direct a DNA polymerase to synthesize the complementary DNA strands. Only DNA with the target sequence will be copied, because DNA polymerase can only copy the molecules with the primer attached; this is the reason why the non-cancer alleles will not be amplified. With each PCR cycle, partial target sequences and double stranded molecules, which contain only the target sequence, are “created” (also known as “amplified”). As the cycles continue, more target sequences of double stranded molecules (with the target sequence: rs17879961) and partial target sequences are produced. Consequently, with each PCR cycle, the number of strands with the target sequence grows exponentially (2^n). Essentially, after all cycles are complete, the end result will be a large number of pure target sequence molecules that only code for the SNP rs17879961 (the cancer-associated marker). Feature 2: Consumables KitIn our kit we will be including the PCR tubes, the PCR tube container as well as holder, the newly designed camera/phone stand for the fluorimeter, as well as a micropipetor along with tips for the micropipetor.
Feature 3: PCR Machine HardwareThe PCR Machine will be used in the same way as it was set up during the previous lab, the only difference will be the logging software used during the process. The PCR machine will duplicate the DNA strands in order to detect the cancer segment of the DNA, by denaturing the DNA with high temperatures, once the DNA is separated annealing begins and primers are attached to the DNA segments, thus synthesizing complementary strands of DNA and held at a constant temperature to ensure the DNA is extended completely. It was noted that one of the weakness for the PCR machine was that it didn't have a way of logging/recorded data, during the time that the machine was running. Our team is going to address this problem by creating a communication connection between the data of the PCR machine to a computer. We will be doing this by adding a logging program and USB connection to the PCR machine that will automatically start and record all data being given off by the PCR machine. Feature 4: Fluorimeter HardwareWe felt that the fluorimeter did the job it was designed to do efficiently. We did, however, alter the design to the phone stand used within the fluorimeter. We designed a new stand that allows various models of phones to be used in the fluorimeter in both the upright and horizontal position.
Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic ApproachCalculation 3 is the positive predictive value: the probability that a cancerous patient will test positive with the PCR-based diagnostic test. The percent value for calculation 3 is a small value and has low specificity, telling us that there are a number of results that came back as false-positives. This informs us that some patients are non-cancerous but came back with a positive test result from the PCR-based diagnostic test. Calculation 4 is the negative predictive value: the probability that a non-cancerous patient will test negative with the PCR-based diagnostic test. The percent value for calculation 4 is close to one and has high sensitivity, suggesting that this test is a good standard. |