BME100 f2013:W900 Group5 L6: Difference between revisions
Line 75: | Line 75: | ||
* (3) Hydrophobic glass plates'' | * (3) Hydrophobic glass plates'' | ||
'''''The following issues will be addressed with the new and improved functionality of the box and | |||
'''''The following issues will be addressed with the new and improved functionality of the box and its content''': | |||
* The issue that needed to be addressed was the issue of the light sensitive enzymes"SYBR green" can be degraded with the ambient light from the room which in turn can diminish the amount of fluoresce that is produced by the "SYBR green" dye under the detection of the cell phone megapixel camera. | * The issue that needed to be addressed was the issue of the light sensitive enzymes"SYBR green" can be degraded with the ambient light from the room which in turn can diminish the amount of fluoresce that is produced by the "SYBR green" dye under the detection of the cell phone megapixel camera. | ||
* Another issue that was addressed is the neatness and limiting the false positive and the cross contamination associated with working with fluids and being in a dynamic lab environment. The solution would be to keep all of the items that you are using in one localized area and you testing equipment nearby but isolated. WIth two levels in the box; the upper level has a lid which you can open and select the enzyme/aquous solution that you want to work with, close the box and proceed the lower level; the lower level contains the cellphone holder and the fluorometer, and then conduct your expirement and discard. These steps can become second nature and the risk of cross contamination is dramatically reduced and the over functionality is exponentially improved. | * Another issue that was addressed is the neatness and limiting the false positive and the cross contamination associated with working with fluids and being in a dynamic lab environment. The solution would be to keep all of the items that you are using in one localized area and you testing equipment nearby but isolated. WIth two levels in the box; the upper level has a lid which you can open and select the enzyme/aquous solution that you want to work with, close the box and proceed the lower level; the lower level contains the cellphone holder and the fluorometer, and then conduct your expirement and discard. These steps can become second nature and the risk of cross contamination is dramatically reduced and the over functionality is exponentially improved. |
Revision as of 19:14, 26 November 2013
BME 100 Fall 2013 | Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | |||||
OUR COMPANY
LAB 6 WRITE-UPComputer-Aided DesignTinkerCAD We used TinkerCAD to make improvements on the PCR test tubes. We made each test tube about 20% longer and labeled the caps of each tube. One row is red with the numbers zero through three and the other row is blue with the same numbers. We also a stamp that will hold the test tubes completely off the ground so that there is no wobbling when working with them. http://openwetware.org/images/4/4c/Tinkercad_pic_-1_for_BME_100.png
Using TinkerCAD to design and print out a specialized camera holder would make the design of the experiment optimal. By personalizing the camera holder, the camera being used will be fitted more efficiently, making the possibility of error (e.g. by bumping the camera and shifting it in open space on the general camera holder) less.
Feature 1: Cancer SNP-Specific PrimersBackground on the cancer-associated mutation
- GGAAGTGGGTCCTAAAAACTCTTACA
- TGCATACATAGAAGATCACAGTGGC
Feature 2: Consumables KitThe consumables that will be provided the box will go as follows:
Feature 3: PCR Machine Hardware[Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]
Feature 4: Fluorimeter Hardware[Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] Essentially the redesigned fluorimeter would be readily and easily included within the system. This is ue to the accessibility of the new and compact design that would enhance the amount of workspace needed to conduct these experiments. The whole purpose of the system is to maximize the total efficiency from every angle and eliminate any errors that could cause faulty results. [Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] A major weakness that was spotted within the fluorimeter was that achieving a picture, and coordinating the lid drop to shield the light was a major problem. What the group decided to do was design a box similar to the one that has been used within the lab. The box would instead have a button that could be pressed to easily take a picture in the dark without having to time it perfectly. What would have to be done is mount a camera on the fluorimeter or where the camera mount was originally designed to be placed. From that vantage point a clear image could be taken, it would however be slightly more costly, however, the improvement and lack of errors would be substantial due to the fact that the use of the fluorimeter for this particular set up was determining a cancer sequence or genome. This really drove the group to proceed with making a full proof device that would function properly and without and troublesome miscommunications as well. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.] |