BME100 f2013:W900 Group16 L6: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(New page: {|{{table}} width="800" |- |style="background-color: #EEE"|128px<span style="font-size:22px;"> BME 100 Fall 2013</span> |style="background-color: #F2F2F2" | ...)
 
 
(21 intermediate revisions by 5 users not shown)
Line 13: Line 13:
{| style="wikitable" width="700px"
{| style="wikitable" width="700px"
|- valign="top"
|- valign="top"
| [[Image:BME103student.jpg|100px|thumb|Name: student]]
| [[Image:flower123.jpg|100px|thumb|Laura Stanovich]]
| [[Image:BME103student.jpg|100px|thumb|Name: student]]
| [[Image:Butterfly123.jpg|100px|thumb|Aakriti Gupta]]
| [[Image:BME103student.jpg|100px|thumb|Name: student]]
| [[Image:Ballet123.jpg|100px|thumb|Meilin Ossanna]]
| [[Image:BME103student.jpg|100px|thumb|Name: student]]
| [[Image:Potato123.jpg|100px|thumb|Paul Lim]]
| [[Image:BME103student.jpg|100px|thumb|Name: student]]
| [[Image:Rice123.png|100px|thumb|Kevin Liao]]
| [[Image:BME103student.jpg|100px|thumb|Name: student]]
|}
|}
''[Instructions: add the name of your team's company and/or product here]''
<!-- Note: Delete any image placeholders that you do not need. -->


=LAB 6 WRITE-UP=
=LAB 6 WRITE-UP=
Line 33: Line 26:
'''TinkerCAD'''<br>
'''TinkerCAD'''<br>


''[Instructions: A short summary (up to five sentences) of the TinkerCAD tool and how you used it in lab on November 20th]''<br>
In this lab, TinkerCAD was used to make changes to the micropipette tubes. In the original design, it was difficult to determine which tube went to which material, and in order to fix this, numbers were added on the side of the tubes. To complete this, the main tool used was the change of workplane. The workplane was changed to be flat against the side of the tubes so that numbers could be directly written on the surface. The tool to change colors was also used to make them all uniform in the set. 


''[Instructions: Show an image of your TinkerCAD PCR tube design here]''
[[Image:Numbered.png]]




'''Implications of Using TinkerCAD for Design'''<br>
'''Implications of Using TinkerCAD for Design'''<br>


''[Instructions: A short paragraph discussing just one possible way to use TinkerCAD for something practical...like redesigning the OpenPCR machine, fluorimeter, camera holder, printing out some of the smaller plastic items on demand, etc. There are lots of possibilities...pick just ONE.]''<br>
Because of the errors created with the camera holder, it would be more practical to change the design so that it is easier to use. This could easily be completed on TinkerCAD because the current version could be modified into one that would be easier to use. One idea for this would be to make it so that the camera holder slides out from the fluorimeter so that it is able to stay a constant distance away without being moved. Also, it would be beneficial for the phone to be standing completely upright when the images are being taken. This would result in a clearer picture that is able to correctly detect the amount of light in each drop of substance. To demonstrate this on TinkerCAD, new shapes could be added in order to demonstrate how the camera holder would slide out from the fluorimeter. Also, The front of the camera stand could be extended to be completely vertical and taller to have a straight on picture of the device.
 
 
<br>
<!-- Note: Be sure to delete the text in brackets: ''[ ]'' -->


==Feature 1: Cancer SNP-Specific Primers==
==Feature 1: Cancer SNP-Specific Primers==
''[Instructions: This information will come from the Week 9 exercises you did in lab. Your notes should be in a pdf file that is saved on Blackboard under your group.]''


'''Background on the cancer-associated mutation'''<br>
'''Background on the cancer-associated mutation'''<br>
Nucleotides are the building blocks of nucleic acids. They usually include a phosphate and a nitrogen base such as Adenosine (A), Thymine (T), Guanine (G), or Cytosine (C). When a sequence of nucleotides are put together, they either create a strand of DNA or RNA. During the comparison between DNA sequences from different individuals from the same population species, if one sequence shows an A in a certain location whereas the other sequences show a G, this is called a mutation or a polymorphism. In essence, a polymorphism is when 2 different phenotypes occur in the same population species.  <br>


''[Instructions: Use the answers from questions 3, 4, 5, and 7 to compose, in your own words, a paragraph about rs17879961]''
In the case provided to us,the gene rs 17879961 is a pathogenic single nucleotide polymorphism (SNP) that is usually found in Homo sapiens. This mutation occurs in the 22nd chromosome out of the 23 chromosomes that Homo sapiens usually have. The gene that this SNP affects is the CHEK2 which is known as the Checkpoint Kinase 2. The CHEK2 protein is cell cycle regulator that works to inhibit the CDC25C phosphatase which prevents entry into mitosis. The CHEK2 protein has also been found to stabilize the tumor suppressor protein p53 causing the cell cycle to go into arrest during the G1 stage. <br>
 
 


'''Primer design'''<br>
'''Primer design'''<br>


* Forward Primer: ''[Instructions: write the sequence of the forward primer]''
* Forward Primer: TGTAAAGGACAGGACAAATTT <br>
* Cancer-specific Reverse Primer: ''[Instructions: write the sequence of the forward primer]''
* Cancer-specific Reverse Primer: TGGGTCCTAAAAACTCTTAC <br>


How the primers work: ''[Instructions: explain what makes the primers cancer-sequence specific. In other words, explain why the primers will amplify DNA that contains the cancer-associated SNP rs17879961, and will not exponentially amplify DNA that has the non-cancer allele.]''
How the primers work: During the denaturing of DNA in the PCR reaction, the 94°C temperature causes the double helix DNA to unwind and separate into two complementary strands. As the process moves along to the annealing step, the primers attach themselves to the target sequence which is used as a template for the amplification. In this situation, the target sequence is the rs 17879961 SNP which is the cancer-associated SNP. In simple terms, PCR is the amplification of the target sequence and since the target sequence here is the cancer-associated SNP, this particular SNP will be found in every PCR result because that specific sequence was used as the template of the amplification.


==Feature 2: Consumables Kit==


The consumables, such as the micro-pipette tubes, micro-pipette, tips, PCR primers, and PCR mix will be packaged in an unfoldable box that functions as a "mini-lab station". The micro-pipette tubes will be packaged and stored in micro-pipette tube racks that are built into the sides of the box. While the racks can remain on the sides of the box, they are also removable so the individual can place the racks on the table to have better access to specific tubes during the experiment. The micro-pipette tubes will also have a non-glossy, smear-free coating on the side to make labeling each tube easier. A black foam stand with holes to insert micro-pipette tubes into is also included. Similar to the design of a micro-pipette tip holder, this stand is intended to hold micro-pipette tubes that have PCR mixtures, primers, and SBYR green. The PCR mixtures and primers come in clear bottles and are stored in a black foam stand.


<!-- Note: Be sure to delete the instruction text in brackets: ''[ ]'' -->


==Feature 2: Consumables Kit==
[[Image:Tubeholder11.JPG]]


''[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.]''


''[Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]''
Difficulty labeling micro-pipette tubes and larger tubes, bleaching of SYBR green, and disorganization of the lab materials are some of the problems within the current consumables system. The new packaging will solve some of these problems. The unfoldable box serves as a “mini-lab station”. Each of the items needed to conduct the experiment has a specific storage place to keep materials organized throughout the experiment and is easily removable when needed in the lab process . The addition of a non-glossy coating to the outside of the micro-pipette tubes will allow individuals to properly label each tube without the worry that the writing will rub off. The black foam stands are designed to prevent bleaching of SYBR green and other PCR related mixtures. By keeping the tubes and bottles in the dark and away from the fluorescent lights above, the mixtures will have less of a chance of bleaching and ruining lab results. The stands should be used during experiments so the tubes are easily accessible but are also protected from the surrounding environment.
 
 
<!-- Note: Be sure to delete the text in brackets: ''[ ]'' -->


[[Image:tube11.jpg]]


==Feature 3: PCR Machine Hardware==
==Feature 3: PCR Machine Hardware==


''[Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.]''
The PCR machine will be utilized in parallel with the Consumables Kit to amplify DNA. The PCR machine will contain a back-lit LCD display, power supply, heat sink, open PCR control circuit, heating elements, and thermopile. The preceding components are essential in a thermal cycler allowing for denaturation, annealing, elongation, and resulting exponential growth of DNA. The PCR machine will run the cycles with the prepared samples created with the Consumables Kit. To obtain ease and increased efficiency in performing DNA amplification for lab/facility use, modifications of the machine will be implemented.


''[Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]''


The PCR machine will contain features such as a decreased size for portability, functionality without the need of an external computer, and reliable performance all around. In order to decrease the size of the machine, this would require a redesign in the unit initially through a 3D-modeling software to remove as much empty space in the machine as possible and scaling down on certain components. An approach may include scaling down the internal circuit board, a higher resolution LCD to display more content, or a smaller power supply. To have the PCR machine run independently, the device will encompass integrated software enabling the input of desired parameters without the need of a computer. Lastly, to achieve reliable performance, the cycles need to be accurate and consistent. This would require a better monitoring of temperatures with a better heating element and sensor. A higher end heater and cooler will heat faster to required temperatures.  As a result the times for PCR to occur would decrease and the efficiency of the test performed would increase.


<!-- Note: Be sure to delete the text in brackets: ''[ ]'' -->
[[Image:pcr11.jpg]]


==Feature 4: Fluorimeter Hardware==
==Feature 4: Fluorimeter Hardware==
The fluorimeter will be used for the same purpose as it is now: to fluoresce the drop of SYBR green and PCR product sample to identify whether or not the sample tests positive or negative for a cancer sequence. Cell phone cameras capture the image of the fluoresced drop. The phone itself is placed in an adjustable cradle which will make the phone perpendicular to the table and the camera parallel to the drop. The bottom of the stand also holds the phone cradle on an adjustable arm that slides out of the fluorimeter.  Once the set-up is complete, a black box is needed to cover the entire design to block surrounding light. This ensures the best image to use for analyzing if the sample is cancer positive or negative.


''[Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.]''
Finding the best distance between the fluorimeter and phone and making the camera parallel to the drop were two the biggest challenges in the original design. Therefore the adjustable phone cradle and extendable arm aim to remedy these two issues. The new cradle design will have adjustable sides to fit the thickness of various phones used for to conduct an experiment, enabling the phone to stand up right. One of the problems encountered with the current version is that the phone was diagonal in the stand. This made centering the drop on the screen difficult and slowed down the image-taking process by having to readjust the angle each time. By allowing the cradle to be tailored to each phone, the individuals can adjust phone and camera position to allow the camera to be parallel to the drop each time. Finding and keeping the proper distance between the camera and the drop was difficult because the cradle often moved during the process. The extendable arm helps solve this difficulty by being attached to the fluorimeter stand itself. Instead of having to measure and check each new picture that the cradle is in the right spot to get an accurate image, individuals can set the specific distance at the beginning and secure the arm so it does not move throughout the experiment.
 
''[Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]''




<!-- Note: Be sure to delete the text in brackets: ''[ ]'' -->
[[Image:Iphone holder.jpg]]


==Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach==
==Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach==


''[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]''
In calculation 3, the answer was very small: less than 50%. Therefore, the probability in predicting whether a patient that has the disease will test positive is very low. This shows that the CHEK2 PCR diagnostic test system is neither sensitive nor reliable. If the value for calculation 3 was close to 1, it would show that CHEK2 PCR is very sensitive and very reliable in predicting cancer in patients. In calculation 4, the answer was greater than 1, which is impossible for a probability. This calculation is supposed to show the probability that the diagnostic test correctly diagnoses a patient that does not cancer as negative for cancer. However, because the probability calculated in the experiment was greater than 1, it shows that CHEK2 PCR is not reliable in predicting cancer. If the calculation was very small, it would show, too, that CHEK2 PCR is not reliable in predicting cancer and is not very specific, while if it was close to 1, it would show that CHEK2 PCR is highly reliable in predicting cancer and is very specific.

Latest revision as of 09:11, 27 November 2013

BME 100 Fall 2013 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR COMPANY

Laura Stanovich
Aakriti Gupta
Meilin Ossanna
Paul Lim
Kevin Liao

LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD

In this lab, TinkerCAD was used to make changes to the micropipette tubes. In the original design, it was difficult to determine which tube went to which material, and in order to fix this, numbers were added on the side of the tubes. To complete this, the main tool used was the change of workplane. The workplane was changed to be flat against the side of the tubes so that numbers could be directly written on the surface. The tool to change colors was also used to make them all uniform in the set.


Implications of Using TinkerCAD for Design

Because of the errors created with the camera holder, it would be more practical to change the design so that it is easier to use. This could easily be completed on TinkerCAD because the current version could be modified into one that would be easier to use. One idea for this would be to make it so that the camera holder slides out from the fluorimeter so that it is able to stay a constant distance away without being moved. Also, it would be beneficial for the phone to be standing completely upright when the images are being taken. This would result in a clearer picture that is able to correctly detect the amount of light in each drop of substance. To demonstrate this on TinkerCAD, new shapes could be added in order to demonstrate how the camera holder would slide out from the fluorimeter. Also, The front of the camera stand could be extended to be completely vertical and taller to have a straight on picture of the device.

Feature 1: Cancer SNP-Specific Primers

Background on the cancer-associated mutation
Nucleotides are the building blocks of nucleic acids. They usually include a phosphate and a nitrogen base such as Adenosine (A), Thymine (T), Guanine (G), or Cytosine (C). When a sequence of nucleotides are put together, they either create a strand of DNA or RNA. During the comparison between DNA sequences from different individuals from the same population species, if one sequence shows an A in a certain location whereas the other sequences show a G, this is called a mutation or a polymorphism. In essence, a polymorphism is when 2 different phenotypes occur in the same population species.

In the case provided to us,the gene rs 17879961 is a pathogenic single nucleotide polymorphism (SNP) that is usually found in Homo sapiens. This mutation occurs in the 22nd chromosome out of the 23 chromosomes that Homo sapiens usually have. The gene that this SNP affects is the CHEK2 which is known as the Checkpoint Kinase 2. The CHEK2 protein is cell cycle regulator that works to inhibit the CDC25C phosphatase which prevents entry into mitosis. The CHEK2 protein has also been found to stabilize the tumor suppressor protein p53 causing the cell cycle to go into arrest during the G1 stage.

Primer design

  • Forward Primer: TGTAAAGGACAGGACAAATTT
  • Cancer-specific Reverse Primer: TGGGTCCTAAAAACTCTTAC

How the primers work: During the denaturing of DNA in the PCR reaction, the 94°C temperature causes the double helix DNA to unwind and separate into two complementary strands. As the process moves along to the annealing step, the primers attach themselves to the target sequence which is used as a template for the amplification. In this situation, the target sequence is the rs 17879961 SNP which is the cancer-associated SNP. In simple terms, PCR is the amplification of the target sequence and since the target sequence here is the cancer-associated SNP, this particular SNP will be found in every PCR result because that specific sequence was used as the template of the amplification.

Feature 2: Consumables Kit

The consumables, such as the micro-pipette tubes, micro-pipette, tips, PCR primers, and PCR mix will be packaged in an unfoldable box that functions as a "mini-lab station". The micro-pipette tubes will be packaged and stored in micro-pipette tube racks that are built into the sides of the box. While the racks can remain on the sides of the box, they are also removable so the individual can place the racks on the table to have better access to specific tubes during the experiment. The micro-pipette tubes will also have a non-glossy, smear-free coating on the side to make labeling each tube easier. A black foam stand with holes to insert micro-pipette tubes into is also included. Similar to the design of a micro-pipette tip holder, this stand is intended to hold micro-pipette tubes that have PCR mixtures, primers, and SBYR green. The PCR mixtures and primers come in clear bottles and are stored in a black foam stand.



Difficulty labeling micro-pipette tubes and larger tubes, bleaching of SYBR green, and disorganization of the lab materials are some of the problems within the current consumables system. The new packaging will solve some of these problems. The unfoldable box serves as a “mini-lab station”. Each of the items needed to conduct the experiment has a specific storage place to keep materials organized throughout the experiment and is easily removable when needed in the lab process . The addition of a non-glossy coating to the outside of the micro-pipette tubes will allow individuals to properly label each tube without the worry that the writing will rub off. The black foam stands are designed to prevent bleaching of SYBR green and other PCR related mixtures. By keeping the tubes and bottles in the dark and away from the fluorescent lights above, the mixtures will have less of a chance of bleaching and ruining lab results. The stands should be used during experiments so the tubes are easily accessible but are also protected from the surrounding environment.

Feature 3: PCR Machine Hardware

The PCR machine will be utilized in parallel with the Consumables Kit to amplify DNA. The PCR machine will contain a back-lit LCD display, power supply, heat sink, open PCR control circuit, heating elements, and thermopile. The preceding components are essential in a thermal cycler allowing for denaturation, annealing, elongation, and resulting exponential growth of DNA. The PCR machine will run the cycles with the prepared samples created with the Consumables Kit. To obtain ease and increased efficiency in performing DNA amplification for lab/facility use, modifications of the machine will be implemented.


The PCR machine will contain features such as a decreased size for portability, functionality without the need of an external computer, and reliable performance all around. In order to decrease the size of the machine, this would require a redesign in the unit initially through a 3D-modeling software to remove as much empty space in the machine as possible and scaling down on certain components. An approach may include scaling down the internal circuit board, a higher resolution LCD to display more content, or a smaller power supply. To have the PCR machine run independently, the device will encompass integrated software enabling the input of desired parameters without the need of a computer. Lastly, to achieve reliable performance, the cycles need to be accurate and consistent. This would require a better monitoring of temperatures with a better heating element and sensor. A higher end heater and cooler will heat faster to required temperatures. As a result the times for PCR to occur would decrease and the efficiency of the test performed would increase.

Feature 4: Fluorimeter Hardware

The fluorimeter will be used for the same purpose as it is now: to fluoresce the drop of SYBR green and PCR product sample to identify whether or not the sample tests positive or negative for a cancer sequence. Cell phone cameras capture the image of the fluoresced drop. The phone itself is placed in an adjustable cradle which will make the phone perpendicular to the table and the camera parallel to the drop. The bottom of the stand also holds the phone cradle on an adjustable arm that slides out of the fluorimeter. Once the set-up is complete, a black box is needed to cover the entire design to block surrounding light. This ensures the best image to use for analyzing if the sample is cancer positive or negative.

Finding the best distance between the fluorimeter and phone and making the camera parallel to the drop were two the biggest challenges in the original design. Therefore the adjustable phone cradle and extendable arm aim to remedy these two issues. The new cradle design will have adjustable sides to fit the thickness of various phones used for to conduct an experiment, enabling the phone to stand up right. One of the problems encountered with the current version is that the phone was diagonal in the stand. This made centering the drop on the screen difficult and slowed down the image-taking process by having to readjust the angle each time. By allowing the cradle to be tailored to each phone, the individuals can adjust phone and camera position to allow the camera to be parallel to the drop each time. Finding and keeping the proper distance between the camera and the drop was difficult because the cradle often moved during the process. The extendable arm helps solve this difficulty by being attached to the fluorimeter stand itself. Instead of having to measure and check each new picture that the cradle is in the right spot to get an accurate image, individuals can set the specific distance at the beginning and secure the arm so it does not move throughout the experiment.


Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

In calculation 3, the answer was very small: less than 50%. Therefore, the probability in predicting whether a patient that has the disease will test positive is very low. This shows that the CHEK2 PCR diagnostic test system is neither sensitive nor reliable. If the value for calculation 3 was close to 1, it would show that CHEK2 PCR is very sensitive and very reliable in predicting cancer in patients. In calculation 4, the answer was greater than 1, which is impossible for a probability. This calculation is supposed to show the probability that the diagnostic test correctly diagnoses a patient that does not cancer as negative for cancer. However, because the probability calculated in the experiment was greater than 1, it shows that CHEK2 PCR is not reliable in predicting cancer. If the calculation was very small, it would show, too, that CHEK2 PCR is not reliable in predicting cancer and is not very specific, while if it was close to 1, it would show that CHEK2 PCR is highly reliable in predicting cancer and is very specific.