BME100 f2013:W900 Group12 L6: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 72: Line 72:
''[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.]''
''[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.]''


[[Image:consumable kit.jpg]]


In our consumable kit we would include tip refills, rather than box refills.  
 
Our consumable kit we would include a PCR tube plate, micropipettor, pipette tips, PCR tubes and holder, and PCR tube refills. Our pipette tips would be packaged stacked one on top of the other to conserve space and allow for easy loading. The tube plate would resemble a tray that gives easy transport and stability. The individual PCR tubes would come in a small plastic box for ease of handling. We would also include a bag of PCR tube refills, rather than box refills, in order to save plastic and be more environmentally efficient.  


''[Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]''
''[Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]''

Revision as of 13:22, 24 November 2013

BME 100 Fall 2013 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR COMPANY

Name: student
Name: student
Name: student
Name: student
Name: student
Name: student


[Instructions: add the name of your team's company and/or product here]


LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD

[Instructions: A short summary (up to five sentences) of the TinkerCAD tool and how you used it in lab on November 20th]

[Instructions: Show an image of your TinkerCAD PCR tube design here]


Implications of Using TinkerCAD for Design

[Instructions: A short paragraph discussing just one possible way to use TinkerCAD for something practical...like redesigning the OpenPCR machine, fluorimeter, camera holder, printing out some of the smaller plastic items on demand, etc. There are lots of possibilities...pick just ONE.]



Feature 1: Cancer SNP-Specific Primers

Background on the cancer-associated mutation

A nucleotide composed of a phosphate group linked by a phosphoester bond ( deoxyribose) which also known as amino acid. A polymorphism is a common variation in the sequence of DNA among individuals. The SNP which stands for single nucleotie polymorphism. We want to consider SNP rs17879961 known as a cancer-associated mutation that can be found in homo sapiens. The Clinical significance of SNP rs17879961 is the pathogenic allele. Moreover, this SNP find on 22nd chromosome with 23 pairs of chromosomes in humans. The affected gene is called CHEK2 which stands for the checkpoint kinase 2. CHEK2 inhibits CDC25C phosphate , preventing mitosis an leading to cell cycle arrest in G1 which links to Li-fraumeni syndrome. The most important thing is that this SNP can cause the sarcomas, breast cancer, brain and tumor.



Primer design

  • Forward Primer: 5'- TGTAAGGACAGGACAAATTT
  • Cancer-specific Reverse Primer: 5'- CACTAGAAGATACATACGTC

How the primers work: [Instructions: explain what makes the primers cancer-sequence specific. In other words, explain why the primers will amplify DNA that contains the cancer-associated SNP rs17879961, and will not exponentially amplify DNA that has the non-cancer allele.]



Feature 2: Consumables Kit

[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.]


Our consumable kit we would include a PCR tube plate, micropipettor, pipette tips, PCR tubes and holder, and PCR tube refills. Our pipette tips would be packaged stacked one on top of the other to conserve space and allow for easy loading. The tube plate would resemble a tray that gives easy transport and stability. The individual PCR tubes would come in a small plastic box for ease of handling. We would also include a bag of PCR tube refills, rather than box refills, in order to save plastic and be more environmentally efficient.

[Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]

A major problem was the SYBR green solution's sensitivity to light. After being exposed to the lighting in the room for an extended period of time, bleaching began to occur causing skewed readings and results. One way to account for this issue would be to make the tops/lids of the tube a thicker material that is less easily penetrated by light, as well as make the lids a solid white color that will reflect some of the light. Another option would be to include a covering of sorts in the kit that holds the tubes. Composed of a more substantial material like a thicker plastic or ceramic, the covering would look like a small table that you would just put the SYBR green solution tubes/holder under while not using them.

Another problem with the consumables kit is the amount of waste you produce from the amount of plastic used in having to discard so many pipette tips and PCR tubes. Because these materials are considered "Hazardous Waste" you cannot recycle the actual tips or reuse the materials. For this reason, the focus should be on being economical in the use of the pipette tip box. The majority of the plastic used comes from the box, rather than the tips. By buying bags of individual pipette tips, and refilling the box, you avoid having to throw away the plastic-consuming box after you use up all its tips.


Feature 3: PCR Machine Hardware

[Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.]

[Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]


Feature 4: Fluorimeter Hardware

[Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.]

[Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]


Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]