BME100 f2013:W900 Group12 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Courtney Van Bussum Name: Swathi Harikumar Name: Nhi Nguyen Name: Christopher Lae Name: Swaroon Sridhar [Instructions: add the name of your team's company and/or product here] LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is a web-based 3-D application. It allows for easy and clear creation of items in 3-D form in order for prototyping and production by companies. This tool is beginning to be used in the biomedical field for advanced 3-D printing. In the lab, a new and improved design of PCR tubes is created for a new PCR application kit produced by our company. Many of weaknesses that were experienced from the original PCR tubes was corrected and the strengths were kept. TinkerCAD allowed our company to design the item with precision and improve certain parts without wasting time and resources producing the actual 3-D product until it can be improved no more. Implications of Using TinkerCAD for Design TinkerCAD can be used to redesign many items, such as the camera holder for the fluorimeter. The design of the fluorimeter has many weakness. The lack of a camera holder affects the quality of the pictures taken by the device. A camera holder can be designed using the TinkerCAD application. This device would be large enough to accommodate a smartphone with stability. It should be able to balance the phone so that the camera is visible and the subject is centered on the screen. The new design can be created in a short time using the TinkerCAD because of it's user friendly options. The design could then be sent to a 3-D printer and printed out on demand. There are many possibilities for using TinkerCAD to improve the designs of the machines used in the experiment. Due to the simple and fast process, TinkerCAD is a effective and efficient application to be used in future device design. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation A nucleotide composed of a phosphate group linked by a phosphoester bond ( deoxyribose) which also known as amino acid. A polymorphism is a common variation in the sequence of DNA among individuals. The SNP which stands for single nucleotide polymorphism. We want to consider SNP rs17879961 known as a cancer-associated mutation that can be found in homo sapiens. The Clinical significance of SNP rs17879961 is the pathogenic allele. Moreover, this SNP find on 22nd chromosome with 23 pairs of chromosomes in humans. The affected gene is called CHEK2 which stands for the checkpoint kinase 2. CHEK2 inhibits CDC25C phosphate , preventing mitosis an leading to cell cycle arrest in G1 which links to Li-fraumeni syndrome. The most important thing is that this SNP can cause the sarcomas, breast cancer, brain and tumor. Primer design Forward Primer: 5'- TGTAAGGACAGGACAAATTT Cancer-specific Reverse Primer: 5'- CACTAGAAGATACATACGTC How the primers work: ' In order to amplify the DNA, each PCR reaction need to have two primers based on the forward primer that we design. This primer contributes to make PCR work. The numerical position 200 bases to the left of the cancer single nucleotide polymorphism (SNP) is 29120887 which means the forward primer release from the top strand of DNA.It is known that the non-cancer allele include ATT while the cancer allele contains the sequence: ACT. The primers will work through the process with the forward primer and the reverse primer. In addition to this, we already know that the cancer specific primer is formed which the reverse primer will bind only to a completing cancer single nucelotide (SNP) that contains the sample of the patients. After that, the forward primer will bind 100% to the sample of patient. This is the whole process to apmlify the DNA. Unless the primer can bind 100% to the template( sample of patient), the PCR can not happened and the template will consists of the non-cancer allele with the PCR result is: the strand will not amplify. Feature 2: Consumables Kit Our consumable kit we would include a PCR tube plate, micropipettor, pipette tips, PCR tubes and holder, and PCR tube refills. Our pipette tips would be packaged stacked one on top of the other to conserve space and allow for easy loading. The tube plate would resemble a tray that gives easy transport and stability. The individual PCR tubes would come in a small plastic box for ease of handling. We would also include a bag of PCR tube refills, rather than box refills, in order to save plastic and be more environmentally efficient. A major problem was the SYBR green solution's sensitivity to light. After being exposed to the lighting in the room for an extended period of time, bleaching began to occur causing skewed readings and results. One way to account for this issue would be to make the tops/lids of the tube a thicker material that is less easily penetrated by light, as well as make the lids a solid white color that will reflect some of the light. Another option would be to include a covering of sorts in the kit that holds the tubes. Composed of a more substantial material like a thicker plastic or ceramic, the covering would look like a small table that you would just put the SYBR green solution tubes/holder under while not using them. Another problem with the consumables kit is the amount of waste you produce from the amount of plastic used in having to discard so many pipette tips and PCR tubes. Because these materials are considered "Hazardous Waste" you cannot recycle the actual tips or reuse the materials. For this reason, the focus should be on being economical in the use of the pipette tip box. The majority of the plastic used comes from the box, rather than the tips. By buying bags of individual pipette tips, and refilling the box, you avoid having to throw away the plastic-consuming box after you use up all its tips. Feature 3: PCR Machine Hardware [Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 4: Fluorimeter Hardware [Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] [Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]