BME100 f2013:W1200 Group6 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Jenny Chen Tracy Lopez Nayobe Bivins Alex Bugarin Nicholas Kilpatrick [Instructions: add the name of your team's company and/or product here] LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is an online site that allows the user to create 3D designs easily. By combining and manipulation basic shapes, any design can be created. There are special tools and shapes that allow the user to create precise details. Once designed, it can be sent to a 3D printer to get a physical model by using a standard STL file. We used TinkerCAD to modify a set of tubes used in PCR. 2-3 sentences: how we changed the tubes in tinkercad [Instructions: Show an image of your TinkerCAD PCR tube design here] Implications of Using TinkerCAD for Design [Instructions: A short paragraph discussing just one possible way to use TinkerCAD for something practical...like redesigning the OpenPCR machine, fluorimeter, camera holder, printing out some of the smaller plastic items on demand, etc. There are lots of possibilities...pick just ONE.] Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation Carbohydrates, proteins, and lipids form the central structure of the working part of most cells. However, they do not have control over the operation of the cells. This responsibility is done by four main groups of biological molecules found in the cytoplasm of the cell called nucleic acids. The dsDNA (double-stranded deoxyribonucleic acid) is responsible for carrying, encoding, and passing the genetic information from one generation to another. The dsDNA is classified as a polymer; that is, it is made up of subunits (called monomers) joined together to make larger molecules. The monomers that make up the dsDNA are called the nucleotides. A nucleotide is made up of three components that are linked together: a phosphate group, a five-carbon sugar molecule (this differentiates dsDNA from the single-stranded RNA), and a nitrogen base (adenine, thymine, guanine, and cytosine). The base pairing of the nucleotides are always complementary. This means that adenine (A) will only pair with thymine (T), and guanine (G) will only bind with cytosine (C). For example, if the DNA sequence of the leading strand is AGCTTGGTACCAGC, then the DNA sequence of the complementary strand should be TCGAACCATGGTCG. For this reason, they dictate the order of the nucleotides being synthesized on the new DNA strand during the replication process. A pair of 23 human chromosomes is called a genome. The human genome is composed of billions of base pairs. When the genome is copied to make a new cell it is not always perfect because a single base pair may: get deleted, added, or substituted. An example of this is when one DNA sequence is CTAAGTA and the other DNA sequence is CTAGGTA (this sequence should be CTAAGTA). The two DNA sequences seem identical; however, they differ at one nucleotide position. Variation or mutation in a single base pair creates a single nucleotide polymorphism (SNP). Our DNA is actually made up of millions of SNPs; this accounts for the many differences (e.g. physical characteristics, development of diseases or our systems’ response to pharmaceutical drugs) we have to each other. The SNP rs17879961 is linked to a high risk of cancers to homo sapiens. It commonly occurs on chromosome number 22 with a clinical significance of a pathogenic allele (i.e. it is in the human gene checkpoint kinase 2 or also called CHEK2). The CHEK2 gene provides codes for making proteins called checkpoint kinase 2. Checkpoint kinase 2 is stimulated when the dsDNA is damaged for whatever reason (e.g. disturbance of homeostasis). Ultimately, it acts as a tumor suppressor by inhibiting cancer cells from rapidly dividing and affecting healthy cells. Primer design Forward Primer: 5' - TGTAAGGACAGGACAAATTT Cancer-specific Reverse Primer: 5' - TGGGTCCTAAAAACTCTTAC How the primers work: [Instructions: explain what makes the primers cancer-sequence specific. In other words, explain why the primers will amplify DNA that contains the cancer-associated SNP rs17879961, and will not exponentially amplify DNA that has the non-cancer allele.] Feature 2: Consumables Kit [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 3: PCR Machine Hardware [Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Weaknesses: The OpenPCR machine: • requires hours to process the results. • looks fragile because of its wood casing. The OpenPCR software: • is intimidating because there is too much reading materials. • is inconvenient and not accessible since the user needs to download it. Feature 4: Fluorimeter Hardware [Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] [Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] WEAKNESS: • Tedious. Takes too long to analyze the DNA samples. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]