BME100 f2013:W1200 Group4 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Madison Cochran Joshua Sarbolandi Pete Akerele-Ale Hannah Switzer Lindsey Macias Company: Everyday DNA LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is a web based tool that allows users to design printable 3D objects. These printable 3D objects are created by various shapes found in the directory towards the right side of the page. TinkerCAD also allows user to have their 3D objects viewable to the public, allowing anyone who wants to improve the object or 'tinker" to do so. This public feature also allows users to use certain objects as the basic design for their 3D objects. TInkerCAD was used in the lab on November 20th to improve the designs of the flourimeter and PCR test tube use in the previous two labs. Implications of Using TinkerCAD for Design TinkerCAD can be very useful when it comes to redesigning an item. For example, our group redesigned the PCR tubes. TinkerCAD allows you to easily make different changes and see how they look in 3D. Our group decided to connect the PCR tubes into two strips of four. This allows the user to handle the tubes better and keep them all together. We also added a small hook in the middle of each strip in order to make it easier to pick up and navigate the PCR tubes. Lastly, we made it so the tubes were already labeled. When we were doing the PCR testing we ran the risk of the labels made in marker coming off. This would've created a problem of not knowing which tube was which. The change we made would fix this problem. TinkerCAD allowed us to change our design around in different ways before making out final decision. It also allowed us to see our design and decide if it would be a beneficial change to make. Feature 1: Cancer SNP-Specific Primers [Instructions: This information will come from the Week 9 exercises you did in lab. Your notes should be in a pdf file that is saved on Blackboard under your group.] Background on the cancer-associated mutation [Instructions: Use the answers from questions 3, 4, 5, and 7 to compose, in your own words, a paragraph about rs17879961] Primer design Forward Primer: ACTCACTTAAACCATATTCT Cancer-specific Reverse Primer: GGTCCTAAAAACTCTTACAC How the primers work: [Instructions: explain what makes the primers cancer-sequence specific. In other words, explain why the primers will amplify DNA that contains the cancer-associated SNP rs17879961, and will not exponentially amplify DNA that has the non-cancer allele.] Feature 2: Consumables Kit The consumables kit will include a stackable tip system that provides a stable stand for the pipette tips. This will hold all the tips in place and prevent them from tipping over when picking up new tips. The new test tubes will be connected into groups of four for convenience and will each contain a small handle to prevent spillage when handling the tubes. The kit will also include a few opaque colored tubes for the SYBR Green as opposed to translucent tubes. This will prevent the SYBR Green from being exposed to flourescent light, which can bleach it and render it ineffective. Another change that can be made to the test tubes is the addition of a label holder. This will be added in order to ensure that the marker used to write the label does not rub off while handling the test tubes. [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 3: PCR Machine Hardware The PCR machine would be included ,in the system, as a method of amplifying the DNA molecules by continuously raising and lowering the temperature of the DNA. This amplification will enable the DNA molecules to be easily analyzed. The major weaknesses of the PCR machine were the speed and size. In order to make a compact PCR, the dimensions of the PCR were altered from 20 x 13 x 25cm to 15 x 10 x 20 cm. The speed was addressed by changing the temperature blocks to an easily heated alloy. The alloys max block ramp rate and max sample rate are respectively 4.15[math]\displaystyle{ ^O }[/math]C/sec and 3.95[math]\displaystyle{ ^O }[/math]C/sec. The new temperature blocks can hold 35 PCR tubes, while the old PCR could only handle 16. [Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 4: Fluorimeter Hardware One of the biggest issues with the fluorimeter was that it was very difficult to regulate the distance between the camera and the fluorimeter and maintain a proper camera angle. To combat this, the new diagnostic system would contain a fluorimeter with a connected phone stand, as seen in the picture. The phone stand can be placed in any of the [Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] [Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach The result from calculation 3 is very small, almost around one tenth of one, and implies that the CHEK2 PCR is not accurate a predicting that a patient possessing the SNP(single-nucleotide polymorphism) CHEK2 will test positive for cancer. The not very big result from calculation 4 implies the CHEK2 PCR is somewhat reliable at predicting that a patient possessing the SNP CHEK2 would not test positive for cancer. [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]