BME100 f2013:W1200 Group2 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Prycilla Jones Name: Terri Bivins Name: Chandler Varone Name: Amber Bengson Name: Emily Mei Polymer ACE 2000 is a product developed by iKiwi Inc a subsidiary of Suntronic LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is an online tool in which can be used to build, redesign, and 3D print whatever is wanted. For the case of this lab, for example, it was used to present a visual image of ideas we want to be designed. It helped us convey how we would change the PCR machine and include all of its needed components so that it could be a more organized device. We were also to show how compact all our redesigns would be so little space would be taken up. Implications of Using TinkerCAD for Design Using TinkerCAD to redesign is very helpful. In the case that an idea for change is formulated for a device, TinkerCAD can be used to put the image and changes down into something that can be seen and assessed visually. It helps point out what changes can be made helpful or what changes would not be a good idea. It is also a cost-efficient way to see a project visually. Instead of using tangible materials to build a model, a virtual model can be easily provided. Not only is it cost-efficient, it also requires little time. Building a tangible model for testing redesigns can cost time, but using TinkerCAD, a model can be made in little time and easily accessible. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation Nucleotides are the basic building blocks of the nucleic acids. When a polymorphism happens it means that their is a genetic variation in the DNA sequence. This specific variation is found in Homo Sapiens (humans), and its clinical significance is Pathogenic. Humans typically have 23 pairs of chromosomes and this SNP is on chromosome number 22. In the Gene View we can see that CHEK2 stands for Checkpoint Kinase 2. CHEK2 is a cell cycle checkpoint regulator and putative tumor suppressor. Primer design Forward Primer: 5’ TGTAAGGACAGGACAAATTT Cancer-specific Reverse Primer: 5’GGTCCTAAAAACTCTTACAC How the primers work: The way that the primers work is as follows: if the template contains the non-cancer allele the regular non-cancer SNP ATT would be seen, however if the Cancer Related allele would have been present you would see the SNP ACT Feature 2: Consumables Kit AMBER THIS IS YOUR PART INSERT YOUR INSIGHT TO BME 100 HERE [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 3: PCR Machine Hardware No major changes were made to the PCR machine hardware. Except for the internal wiring. The wiring for the PCR machine will be neatly organized in a fixed position so that none of the wires accidentally come loose. The goal of the changes to the consumables kit was to make the machine as a whole more portable and less bulky. The primary problem with the PCR machine was that it had so many components and they required more than one person or multiple trips in order to retrieve all the necessary materials. The changes made to the consumables kit enhanced the PCR machine.With the changes made the PCR machine was made more user friendly. Feature 4: Fluorimeter Hardware [Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] [A few weaknesses were made apparent when working with the fluorimeter. The main one being having to use a cell phone camera. At times the settings of the camera had to be reset and low battery power proved to be problematic.This can be easily by adding a built in camera to the fluorimeter. A few other changes that were made include a height adjustment knob for the slide, a slide slot knob to hold the slide in place and a retractable hood to prevent light from entering the fluorimeter while the photo is being taken. The retractable hood would be a part of the fluorimeter so the the whole unit would be one piece instead of a few pieces put together. ] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach Calculation 3 is asking for the probability the patient will develop cancer when given a cancer DNA sequence. The Calculation 3 result is very small which is under 50%. This implies that prediction of the cancer disease development is not sensitive. Calculation 4 is asking for the probability of the patient not developing cancer when not given a DNA sequence. The Calculation 4 result is slightly above 50%. This implies that prediction of cancer disease development is somewhat specific.