BME100 f2013:W1200 Group2 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Prycilla Jones Name: Terri Bivins Name: Chandler Varone Name: Amber Bengson Name: Emily Mei PolymerACE 2000 is a product developed by iKiwi Inc a subsidiary of Suntronic LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is an online tool in which can be used to build, redesign, and 3D print whatever is wanted. For the case of this lab, for example, it was used to present a visual image of ideas we want to be designed. It helped us convey how we would change the PCR machine and include all of its needed components so that it could be a more organized device. We were also to show how compact all our redesigns would be so little space would be taken up. Implications of Using TinkerCAD for Design Using TinkerCAD to redesign is very helpful. In the case that an idea for change is formulated for a device, TinkerCAD can be used to put the image and changes down into something that can be seen and assessed visually. It helps point out what changes can be made helpful or what changes would not be a good idea. It is also a cost-efficient way to see a project visually. Instead of using tangible materials to build a model, a virtual model can be easily provided. Not only is it cost-efficient, it also requires little time. Building a tangible model for testing redesigns can cost time, but using TinkerCAD, a model can be made in little time and easily accessible. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation Nucleotides are the basic building blocks of the nucleic acids. When a polymorphism happens it means that their is a genetic variation in the DNA sequence. This specific variation is found in Homo Sapiens (humans), and its clinical significance is Pathogenic. Humans typically have 23 pairs of chromosomes and this SNP is on chromosome number 22. In the Gene View we can see that CHEK2 stands for Checkpoint Kinase 2. CHEK2 is a cell cycle checkpoint regulator and putative tumor suppressor. Primer design Forward Primer: 5’ TGTAAGGACAGGACAAATTT Cancer-specific Reverse Primer: 5’GGTCCTAAAAACTCTTACAC How the primers work: The way that the primers work is as follows: if the template contains the non-cancer allele the regular non-cancer SNP ATT would be seen, however if the Cancer Related allele would have been present you would see the SNP ACT Feature 2: Consumables Kit The PCR kit will be packaged in such a way that all of the materials needed to perform the polymerase chain reaction will be readily available in a single containment as oppose to making multiple trips. To condense this items into a smaller packaging, a hook will be attached to the PCR box to hold the pipette (which will now be digitally adjusted). Additionally, there will be a drawer on the bottom of the PCR machine to hold the pipette tips. The PCR tubes will be held in a shelf on the box as well. There will also be a refrigerated section of the PCR machine, which serves to prevent bleaching of the SYBR I Green Dye. Probably the biggest issue with the consumables kit was that the packaging was very inconvenient with multiple trips required to obtain all the materials needed or the procedure. To combat this, all of the needed materials will be incorporated into a single container. Another one of the major weaknesses of the pipette was that it was very tedious to adjust the volume each time for pipetting. In order to fix this, the team decided to make the pipette digitally adjustable and electronic, so that the scientist can simply input the desired volume and then begin pipetting immediately afterward. The last problem with the consumables kit was that the SYBR I Green Dye was bleached very easily, also the DNA samples had to be refrigerated. To minimize this inconvenience, a miniature refrigerated section was added to the device for storage of reagents, samples, dyes, PCR mix, etc. Feature 3: PCR Machine Hardware No major changes were made to the PCR machine hardware. Except for the internal wiring. The wiring for the PCR machine will be neatly organized in a fixed position so that none of the wires accidentally come loose. The goal of the changes to the consumables kit was to make the machine as a whole more portable and less bulky. The primary problem with the PCR machine was that it had so many components and they required more than one person or multiple trips in order to retrieve all the necessary materials. The changes made to the consumables kit enhanced the PCR machine.With the changes made the PCR machine was made more user friendly. Feature 4: Fluorimeter Hardware A few weaknesses were made apparent when working with the fluorimeter. The main one being having to use a cell phone camera. At times the settings of the camera had to be reset and low battery power proved to be problematic.This can be easily by adding a built in camera to the fluorimeter. A few other changes that were made include a height adjustment knob for the slide, a slide slot knob to hold the slide in place and a retractable hood to prevent light from entering the fluorimeter while the photo is being taken. The retractable hood would be a part of the fluorimeter so the the whole unit would be one piece instead of a few pieces put together. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach Calculation 3 is asking for the probability the patient will develop cancer when given a cancer DNA sequence. The Calculation 3 result is very small which is under 50%. This implies that prediction of the cancer disease development is not sensitive. In other words, the PCR diagnostic test tells us that the small percentage of people, below 50% range, with the disease for which they are being tested for will test or result to a positive. Calculation 4 is asking for the probability of the patient not developing cancer when not given a DNA sequence. The Calculation 4 result is slightly above 50%. This implies that prediction of cancer disease development is somewhat specific. In other words, the PCR diagnostic test tells us that a percentage, slightly above 50%, of people who do not have the disease being tested for will test or result to a negative.