BME100 f2013:W1200 Group2 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Prycilla Jones Name: Terri Bivens Name: Chandler Varone Name: Amber Bengson Name: Emily Mei [Instructions: add the name of your team's company and/or product here] LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is an online tool in which can be used to build, redesign, and 3D print whatever is wanted. For the case of this lab, for example, it was used to present a visual image of ideas we want to be designed. It helped us convey how we would change the PCR machine and include all of its needed components so that it could be a more organized device. We were also to show how compact all our redesigns would be so little space would be taken up. Implications of Using TinkerCAD for Design Using TinkerCAD to redesign is very helpful. In the case that an idea for change is formulated for a device, TinkerCAD can be used to put the image and changes down into something that can be seen and assessed visually. It helps point out what changes can be made helpful or what changes would not be a good idea. It is also a cost-efficient way to see a project visually. Instead of using tangible materials to build a model, a virtual model can be easily provided. Not only is it cost-efficient, it also requires little time. Building a tangible model for testing redesigns can cost time, but using TinkerCAD, a model can be made in little time and easily accessible. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation Nucleotides are the basic building blocks of the nucleic acids. When a polymorphism happens it means that their is a genetic variation in the DNA sequence. This specific variation is found in Homo Sapiens (humans), and its clinical significance is Pathogenic. Humans typically have 23 pairs of chromosomes and this SNP is on chromosome number 22. In the Gene View we can see that CHEK2 stands for Checkpoint Kinase 2. CHEK2 is a cell cycle checkpoint regulator and putative tumor suppressor. Primer design Forward Primer: 5’ TGTAAGGACAGGACAAATTT Cancer-specific Reverse Primer: 5’GGTCCTAAAAACTCTTACAC How the primers work: [Instructions: explain what makes the primers cancer-sequence specific. In other words, explain why the primers will amplify DNA that contains the cancer-associated SNP rs17879961, and will not exponentially amplify DNA that has the non-cancer allele.] Feature 2: Consumables Kit AMBER THIS IS YOUR PART, INSERT YOUR INSIGHT TO BME 100 HERE [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 3: PCR Machine Hardware [Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 4: Fluorimeter Hardware [Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] [Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]